2009.72 supplementary information - media.nature.com · procedure by damha and co-workers.s2...
TRANSCRIPT
nature nanotechnology | www.nature.com/naturenanotechnology 1
supplementary informationdoi: 10.1038/nnano.2009.72
Modular construction of DNA nanotubes of tunable geometry
and single- or double-stranded character
Faisal A. Aldaye, Pik Kwan Lo, Pierre Karam, Christopher K. McLaughlin, Gonzalo Cosa & Hanadi F. Sleiman*
Department of Chemistry, McGill University, 801 Sherbrooke Street West, Montreal, QC H3A 2K6, Canada.
Here we present an approach to DNA nanotube construction that provides control over their size and geometry, one rung at a time. Specifically, we constructed the first triangular and square-shaped DNA nanotubes that can be assembled in fully double-stranded or partially single-stranded forms.
© 2009 Macmillan Publishers Limited. All rights reserved.
2 nature nanotechnology | www.nature.com/naturenanotechnology
supplementary information doi: 10.1038/nnano.2009.72
S1
Contents I. General S2
II. Instrumentation S2
III. Synthesis of triangle 3 and square 4 S2
IV. Construction of triangular rung 3' and square rung 4' S6
V. Assembly of triangular and square-shaped DNA nanotubes 3nt and 4nt S8
VI. Assembly of triangular DNA nanotubes with radially protruding hairpins 3nt-hp S12
VII. Assembly of partially single-stranded square-shaped DNA nanotubes 4nt-ss S14
VIII. Confocal fluorescence microscopy imaging of 3nt S15
IX. Atomic force microscopy S18
X. References S18
© 2009 Macmillan Publishers Limited. All rights reserved.
nature nanotechnology | www.nature.com/naturenanotechnology 3
supplementary informationdoi: 10.1038/nnano.2009.72
S1
Contents I. General S2
II. Instrumentation S2
III. Synthesis of triangle 3 and square 4 S2
IV. Construction of triangular rung 3' and square rung 4' S6
V. Assembly of triangular and square-shaped DNA nanotubes 3nt and 4nt S8
VI. Assembly of triangular DNA nanotubes with radially protruding hairpins 3nt-hp S12
VII. Assembly of partially single-stranded square-shaped DNA nanotubes 4nt-ss S14
VIII. Confocal fluorescence microscopy imaging of 3nt S15
IX. Atomic force microscopy S18
X. References S18
S2
I. General
Acetic acid, boric acid, cyanogen bromide (5M in acetonitrile), formamide, 4-
morpholineethanesulfonic acid (MES), MgCl2·6H2O, StainsAll®, and tris(hydroxymethyl)-
aminomethane (Tris) are used as purchased from Aldrich. 5-Ethylthiotetrazole, 2000Å
phosphate-CPG with a loading density of 5.4 µmol/g, and reagents used for automated DNA
synthesis are purchased from ChemGenes. Exonuclease VII (ExoVII; source: recombinant), and
sephadex G-25 (super fine DNA grade) are used as purchased from Amersham Biosciences.
Microcon® size-exclusion centrifugal filter devices (YM10) are purchased from Millipore.
RubyRed mica sheets for AFM are purchased from Electron Microscopy Sciences. Etched
silicon cantilevers (OMCL-AC160TS) for AFM imaging are used as purchased from Olympus.
II. Instrumentation
Standard automated oligonucleotide solid-phase syntheses are performed on a Perspective
Biosystems Expedite 8900 DNA synthesizer. UV/vis quantifications are conducted on a Varian
Cary 300 biospectrophotometer. Gel electrophoresis experiments are carried out on an
acrylamide 20 X 20 cm vertical Hoefer 600 electrophoresis unit. Electroelutions are performed
using a Centrilutor® electroeluter from Millipore. Temperature controlled hybridizations are
conducted using a Flexigene Techne 60 well thermocycler. AFM images are either acquired on a
Digital Instruments “Dimension 3100” or on an E-scope microscope (Santa Barbara, CA).
III. Synthesis of triangle 3 and square 4
The construction of templates 3 and 4 involves the initial synthesis of the linear analogues of
triangle 3 and square 4, followed by their subsequent templated cyclization and chemical ligation
to generate the fully cyclic and single-stranded building blocks 3 and 4 (Scheme S1). The linear
analogous of 3 and 4 are synthesized on 2000Å phosphate-CPG with a loading density of 15
µmol/g using standard oligonucleotide synthetic protocols. The coupling of vertex 1 is conducted
using a trityl protected amidite derivative (i.e. 2), with an extended coupling and deprotection
times of 15 and 2 minutes. 2 is prepared according to a previously reported method by Sleiman
and co-workers.S1 In the case of triangle 3, for example, sixty bases of the appropriate sequence
are synthesized and are embedded with three units of vertex 2 at positions 10, 30, and 50. A 5′
phosphate group is then synthetically incorporated to facilitate subsequent chemical ligation.
© 2009 Macmillan Publishers Limited. All rights reserved.
4 nature nanotechnology | www.nature.com/naturenanotechnology
supplementary information doi: 10.1038/nnano.2009.72
S3
The DNA strands are cleaved and deprotected from the solid-support in a concentrated
solution of ammonium hydroxide (55 °C, 12 hrs), purified using 24% 7 M urea polyacrylamide
gel electrophoresis, extracted into 3 mL of water (16 hours, 37 °C), and desalted using Sephadex
G-25 column chromatography. Quantification is carried by UV/vis analysis using Beer’s law
(Atotal = Avertex + ADNA), in which the extinction coefficient of the vertex at 260 nm is calculated to
be 2.30 X 105 L mol-1 cm-1. Table S1 summarizes the sequences of the linear templates 3 and 4,
and of the template strand used to cyclize them.
p p p
5' OH 3' pp
i ii iii
(top) Single-stranded and cyclic DNA templates triangle 3 and square 4, embedded with vertex 1. (bottom) DNA of the appropriate length, sequence, and number of 1 molecules is (i) synthesized on phosphate-CPG to generate a linear analogue of 3, (ii) which is then cyclized using a complementary DNA template, and (iii) chemically ligated to yield the single-stranded and cyclic DNA triangle 3. The black, green and red strands denote different sequences.
13 4 O O
PPOO O
O
DNADNA
OO 1
Scheme S1 Templates 3 and 4.
Sequences (5' - 3')
Linear 3TATTGGTTTG-1-TGACCAATAACACAAATCGG-1-
TCAGTAATCTCTTGAAGGTA-1-GGAAACGACA-p hosp hate
Linear 4TATTGGTTTG-1-TGACCAATAACACAAATCGG-1-AAAGCTTGAAGG
GGGGAATC-1-TCAGTAATCTCTTGAAGGTA-1-GGAAACGACA-p hosp hate
Tem plate CAAACCAATATGTCGTTTCC
Table S1 Sequences of 3, 4, and template strand.
© 2009 Macmillan Publishers Limited. All rights reserved.
nature nanotechnology | www.nature.com/naturenanotechnology 5
supplementary informationdoi: 10.1038/nnano.2009.72
S3
The DNA strands are cleaved and deprotected from the solid-support in a concentrated
solution of ammonium hydroxide (55 °C, 12 hrs), purified using 24% 7 M urea polyacrylamide
gel electrophoresis, extracted into 3 mL of water (16 hours, 37 °C), and desalted using Sephadex
G-25 column chromatography. Quantification is carried by UV/vis analysis using Beer’s law
(Atotal = Avertex + ADNA), in which the extinction coefficient of the vertex at 260 nm is calculated to
be 2.30 X 105 L mol-1 cm-1. Table S1 summarizes the sequences of the linear templates 3 and 4,
and of the template strand used to cyclize them.
p p p
5' OH 3' pp
i ii iii
(top) Single-stranded and cyclic DNA templates triangle 3 and square 4, embedded with vertex 1. (bottom) DNA of the appropriate length, sequence, and number of 1 molecules is (i) synthesized on phosphate-CPG to generate a linear analogue of 3, (ii) which is then cyclized using a complementary DNA template, and (iii) chemically ligated to yield the single-stranded and cyclic DNA triangle 3. The black, green and red strands denote different sequences.
13 4 O O
PPOO O
O
DNADNA
OO 1
Scheme S1 Templates 3 and 4.
Sequences (5' - 3')
Linear 3TATTGGTTTG-1-TGACCAATAACACAAATCGG-1-
TCAGTAATCTCTTGAAGGTA-1-GGAAACGACA-p hosp hate
Linear 4TATTGGTTTG-1-TGACCAATAACACAAATCGG-1-AAAGCTTGAAGG
GGGGAATC-1-TCAGTAATCTCTTGAAGGTA-1-GGAAACGACA-p hosp hate
Tem plate CAAACCAATATGTCGTTTCC
Table S1 Sequences of 3, 4, and template strand.
S4
The clean isolation of the linear analogues of
triangle 3, square 4 and the template strand is
demonstrated using 24% polyacrylamide gel
electrophoresis (Fig. S1). The gel is visualized
following staining in a solution of StainsAll® for
two hours (12.5 mg StainsAll® in 125 mL of
distilled water and 125 mL of formamide).
The templated cyclization of the linear triangle
3 and the linear square 4 is monitored using 10%
native PAGE, and is found to occur quantitatively
for both 3 and 4. Generally, 1.2 X 10-10 moles of
either of the linear strands, and 1.2 X 10-10 moles
of the template strand are mixed in 10 μL of
TAmg buffer (40 mM Tris, 20 mM acetic acid,
12.5 mM MgCl2·6H20; pH 7.8), and are left
incubating at 0 °C for 10 minutes. As seen in Fig.
S2, the templated closure of the linear analogue of
3 (lane 2), and of the linear analogue of 4 (lane 4) occurs quantitatively in both cases (lanes 3 and
5 respectively).
Figure S2 Assembly of cyclic 3 and 4. Native PAGE analysis reveals the clean templated closure of 3(lane 3) and 4 (lanes 5), using their respective linear analogues (lanes 2 and 4, respectively) and the complementary template strand (lane 1).
p
2 3 4 5
OH 5' p3'
p3'
p
1
OH 5'
Figure S1 Template strand, and the linear analogues of 3 and 4. Denaturing PAGE analysis of the linear analogues of 3 (lane 2) and 4 (lanes 3), and of the template strand used to cyclize them (lane 1).
1 2 3
p
p
Template
© 2009 Macmillan Publishers Limited. All rights reserved.
6 nature nanotechnology | www.nature.com/naturenanotechnology
supplementary information doi: 10.1038/nnano.2009.72
S5
Ligations using cyanogen bromide are conducted according to a previously reported
procedure by Damha and co-workers.S2 Typically, 10 µL of cyanogen bromide (5 M in
acetonitrile) is added to the pre-cyclized template in 30 μL of the ligation buffer MES (250 mM
MES, 20 mM MgCl2, pH 7.6), and is left incubating at 0°C for 15 minutes. The resulting mixture
is then recovered using Microcon® size-exclusion centrifugal filter devices (YM10), and analyzed
using denaturing PAGE. As seen in Fig. S3, the cyclization of linear 3 and 4 results in a single
other band of relatively slower mobility assigned to the fully cyclic triangle 3 and square 4,
respectively.
The cyclic nature of triangle 3 and square 4 is confirmed using enzymatic digestion assays
with ExoVII. This enzyme is selective for the digestion of open single-stranded DNA, and will
not digest single-stranded DNA that is cyclized. The digestion of the mixtures generated from the
ligation of 3 and 4 (5 units, 37 °C, 22 mins) results in complete degradation of the linaer
analogues of 3 and 4, and does not affect the bands assigned to cyclic 3 and 4 (Fig. S4). This
confirms the cyclic assignment of triangle 3 and square 4. Finally, 3 and 4 are purified via
electroelution.
p
2 3 4
p
1
4
3
Figure S3 Chemical ligation of 3 and 4. Native PAGE analysis reveals the generation of a single other band of relatively retarded electrophoretic mobility when the cyclic assemblies of 3 (lane 1) and 4 (lane 3) are chemically ligated using cyanogen bromide (lanes 2 and 4, respectively). These single other bands are respectively assigned to the cyclic templates 3 and 4.
© 2009 Macmillan Publishers Limited. All rights reserved.
nature nanotechnology | www.nature.com/naturenanotechnology 7
supplementary informationdoi: 10.1038/nnano.2009.72
S5
Ligations using cyanogen bromide are conducted according to a previously reported
procedure by Damha and co-workers.S2 Typically, 10 µL of cyanogen bromide (5 M in
acetonitrile) is added to the pre-cyclized template in 30 μL of the ligation buffer MES (250 mM
MES, 20 mM MgCl2, pH 7.6), and is left incubating at 0°C for 15 minutes. The resulting mixture
is then recovered using Microcon® size-exclusion centrifugal filter devices (YM10), and analyzed
using denaturing PAGE. As seen in Fig. S3, the cyclization of linear 3 and 4 results in a single
other band of relatively slower mobility assigned to the fully cyclic triangle 3 and square 4,
respectively.
The cyclic nature of triangle 3 and square 4 is confirmed using enzymatic digestion assays
with ExoVII. This enzyme is selective for the digestion of open single-stranded DNA, and will
not digest single-stranded DNA that is cyclized. The digestion of the mixtures generated from the
ligation of 3 and 4 (5 units, 37 °C, 22 mins) results in complete degradation of the linaer
analogues of 3 and 4, and does not affect the bands assigned to cyclic 3 and 4 (Fig. S4). This
confirms the cyclic assignment of triangle 3 and square 4. Finally, 3 and 4 are purified via
electroelution.
p
2 3 4
p
1
4
3
Figure S3 Chemical ligation of 3 and 4. Native PAGE analysis reveals the generation of a single other band of relatively retarded electrophoretic mobility when the cyclic assemblies of 3 (lane 1) and 4 (lane 3) are chemically ligated using cyanogen bromide (lanes 2 and 4, respectively). These single other bands are respectively assigned to the cyclic templates 3 and 4.
S6
IV. Construction of triangular rung 3' and square rung 4'
The construction of the triangular rung 3' and the square rung 4' is conducted using a number of
complementary CS and rigidifying strands RS (Scheme S2). 3', for example, is constructed from
one unit of the triangular template 3, three complementary strands containing sticky-end
overhang cohesions CS1-CS3, and from three rigidifying strands that serve to orient each of these
sticky-ends into one of two lateral directions RS1-RS3.
Assemblies are typically conducted by combining all DNA strands in the correct molar ratios
(final assembly 1.2 X 10-10 moles; 30 μL TAmg buffer), and by incubating at 95 °C for 10
Figure S4 Enzymatic digestions of 3 and 4. The crude mixtures generated from the cyclization of 3 (lane 1) and 4 (lane 3) are enzymatically digested using ExoVII (lanes 2 and 4, respectively), which confirm the cyclic nature of the bands assigned to the single-stranded and cyclic DNA templates 3 and 4.
p
2 3 4
p
1
4
3
Scheme S2 Construction of 3' and 4'.
© 2009 Macmillan Publishers Limited. All rights reserved.
8 nature nanotechnology | www.nature.com/naturenanotechnology
supplementary information doi: 10.1038/nnano.2009.72
S7
minutes followed by slowly cooling to 5 °C over a period of 16 hours. Table S2 summarizes the
sequences of the strands used to construct 3' and 4' from 3 and 4, respectively. This process is
monitored sequentially and is found to occur quantitatively at each step leading to, and including,
the construction of the well-defined triangular and square rungs 3' and 4' (Fig. S5a and S5b).
Figure S5 Construction of 3' and 4'. (a) The single-stranded triangle 3 (lane 1) is sequentially titrated with the complmentary strands CS1-CS3 (lanes 2-4, respectively), and with the RS1-RS3 strands to quantitatively generate a fully assembled triangular rung 3' (lane 5). (b) 4 (lane 1) is similarly titrated with CS1'-CS4' (lanes 2-5, respectively), and RS1'-RS4' to quantitatively generate 4' (lane 6). Inset: An expanded view of the gel to better illustrate the shifts in band mobility for the intermediate assemblies.
Table S2 Sequences of CS and RS.
CS1
CS2
CS3
RS1 TTCAACCTAACAGCAAACCT
RS2 GCAATACTATCAAGAGTTCC
CS1'
CS2'
CS3'
CS4'
RS1' Same as RS1 RS2' Same as RS2
RS3' TTCGATCTGGCCAGCCTTTC RS4' Same as RS3
RS3 TTCCTACCTTGAGATGTCGT
Same as CS1
AAAAAGGAACTCTTGACTGGTTATTGTGTTTAGCCCCAGATCGAAACGAC
ATCTCGAAAGGCTGGTTTCGAACTTCCCCCCTTAGAAGGTAGGAATAGGA
Same as CS3
Sequences (5' - 3')
GCTGGGAAGGTTTGCTGCCTTTGCTGTATAACCAAACATAGTATTGCACCCA
AAAAAGGAACTCTTGACTGGTTATTGTGTTTAGCCAAGGTAGGAATAGGA
TGAAGACGACATCTCAGTCATTAGAGAACTTCCATTTAGGTTGAAAACTCTG
© 2009 Macmillan Publishers Limited. All rights reserved.
nature nanotechnology | www.nature.com/naturenanotechnology 9
supplementary informationdoi: 10.1038/nnano.2009.72
S7
minutes followed by slowly cooling to 5 °C over a period of 16 hours. Table S2 summarizes the
sequences of the strands used to construct 3' and 4' from 3 and 4, respectively. This process is
monitored sequentially and is found to occur quantitatively at each step leading to, and including,
the construction of the well-defined triangular and square rungs 3' and 4' (Fig. S5a and S5b).
Figure S5 Construction of 3' and 4'. (a) The single-stranded triangle 3 (lane 1) is sequentially titrated with the complmentary strands CS1-CS3 (lanes 2-4, respectively), and with the RS1-RS3 strands to quantitatively generate a fully assembled triangular rung 3' (lane 5). (b) 4 (lane 1) is similarly titrated with CS1'-CS4' (lanes 2-5, respectively), and RS1'-RS4' to quantitatively generate 4' (lane 6). Inset: An expanded view of the gel to better illustrate the shifts in band mobility for the intermediate assemblies.
Table S2 Sequences of CS and RS.
CS1
CS2
CS3
RS1 TTCAACCTAACAGCAAACCT
RS2 GCAATACTATCAAGAGTTCC
CS1'
CS2'
CS3'
CS4'
RS1' Same as RS1 RS2' Same as RS2
RS3' TTCGATCTGGCCAGCCTTTC RS4' Same as RS3
RS3 TTCCTACCTTGAGATGTCGT
Same as CS1
AAAAAGGAACTCTTGACTGGTTATTGTGTTTAGCCCCAGATCGAAACGAC
ATCTCGAAAGGCTGGTTTCGAACTTCCCCCCTTAGAAGGTAGGAATAGGA
Same as CS3
Sequences (5' - 3')
GCTGGGAAGGTTTGCTGCCTTTGCTGTATAACCAAACATAGTATTGCACCCA
AAAAAGGAACTCTTGACTGGTTATTGTGTTTAGCCAAGGTAGGAATAGGA
TGAAGACGACATCTCAGTCATTAGAGAACTTCCATTTAGGTTGAAAACTCTG
S8
V. Assembly of triangular and square-shaped DNA nanotubes 3nt and 4nt
Assemblies are typically conducted in 30 μL of TAmg buffer, and involve addition of the double-
stranded linking strands to the already assembled rungs 3' or 4' at 40 °C, for 10 minutes, followed
by the slow cooling to 5 °C over a period of 16 hours. The linking strands are mixed with their
respective rungs, in the correct molar ratio, to generate an assembly with a final concentration of
4.0 X 10-6 mol L-1. Table S3 summarizes the sequences used to assemble 3nt and 4nt. AFM
analysis reveals the clean formation of the triangular and square-shaped DNA nanotubes in high
yields (Fig. S6a), while cross-
sectional analysis show them
all to be of the same size (Fig.
S6b). The square-shaped DNA
nanotubes are similarly
assembled in high yields, and
are of the uniform size (Fig.
S7). It is of interest to note
that sample preparation of the
DNA nanotubes for imaging
using AFM resulted in
nanotube assemblies that are
always somewhat embedded
on the mica surface. Cross-
sectional analysis of 3nt and
4nt is therefore conducted on the phase images, and can only be used to confirm that all of the
DNA nanotube assemblies are of the same size. Given that our AFM images clearly show a
large number of individual, unassociated nanotubes, and that cross-sectional height
analysis reveals all DNA nanotubes within a given assembly to essentially be of the same
height, the observed aggregation in some of the AFM images is most likely due to
association of pre-formed DNA nanotubes during sample drying.
Although it is difficult to obtain an accurate value for the diameter of either 3nt or 4nt using
height images in which the DNA assemblies are somewhat embedded, the relative ratio of the
observed dimensions can be used to better ascertain the formation of triangular and square-shaped
DNA nanotube assemblies of the expected size. The theoretically calculated diameter of 3nt is
Sequences (5' - 3')
LS1 TCCCAGCACATCACCTTGGTTGGCTGCTCATACCAGAGTT
LS2 TTTTTTGACATCACCTTGGTTGGCTGCTCATACTCTGGGT
LS3 CTTCATGACATCACCTTGGTTGGCTGCTCATACTCTCCTA
dsLS1 GTATGAGCAGCCAACCAAGGTGATGT
dsLS23 GAGTATGAGCAGCCAACCAAGGTGATGTCA
LS1' Same as LS1
LS2' Same as LS2
LS3' GAGATTGACATCACCTTGGTTGGCTGCTCATACTCGTCGT
LS4' Same as LS3
dsLS1' Same as dsLS1
dsLS234' Same as dsLS23
Table S3.Sequences of LS and dsLS. LS1-3, dsLS1 and dsLS23 are used
to generate 3nt from 3´, and LS1´-4´, dsLS1´ and dsLS234´ are used to
generate 4nt from 4´.
© 2009 Macmillan Publishers Limited. All rights reserved.
10 nature nanotechnology | www.nature.com/naturenanotechnology
supplementary information doi: 10.1038/nnano.2009.72
S9
8.9 nm, while that of 4nt is 11 nm. Therefore, the relative diameter ratio of 3nt to 4nt is
theoretically expected to be 0.81. The experimentally obtained cross-sectional height analysis of
b
a
Figure S6 AFM characterization of 3nt. (a) AFM analysis of 3nt reveals the formation of extended one-dimensional DNA nanotube assemblies. Bar is 2.5 μm. (b) Cross-sectional analysis shows them all to be of the same size.
© 2009 Macmillan Publishers Limited. All rights reserved.
nature nanotechnology | www.nature.com/naturenanotechnology 11
supplementary informationdoi: 10.1038/nnano.2009.72
S9
8.9 nm, while that of 4nt is 11 nm. Therefore, the relative diameter ratio of 3nt to 4nt is
theoretically expected to be 0.81. The experimentally obtained cross-sectional height analysis of
b
a
Figure S6 AFM characterization of 3nt. (a) AFM analysis of 3nt reveals the formation of extended one-dimensional DNA nanotube assemblies. Bar is 2.5 μm. (b) Cross-sectional analysis shows them all to be of the same size.
S10
Figure S7 AFM characterization of 4nt. (a) AFM analysis of 4nt reveals the formation of extended one-dimensional DNA nanotube assemblies. Bar is 5 μm. (b) Cross-sectional analysis shows them all to be of the same size.
b
a
© 2009 Macmillan Publishers Limited. All rights reserved.
12 nature nanotechnology | www.nature.com/naturenanotechnology
supplementary information doi: 10.1038/nnano.2009.72
S11
the 3nt and 4nt using the height images is consistently found to be 2.95 nm and 3.56 nm for all
nanotubes measured, which translates into a diameter ratio of 3nt to 4nt of 0.83 (Figure S8). This
value is in good agreement with the theoretically calculated value of 0.81, and can be used to
indirectly confirm the formation of triangular and square DNA nanotubes of the expected size.
To determine the thermal stability of our DNA nanotubes, thermal denaturation
experiments are conducted on the assembled triangular DNA nanotube 3nt, on the triangular rung
3', and on the double-stranded linking strands dsLS used to generate the final assembly. As seen
in Fig. S9, 3nt possesses three distinct melting ranges. Individual thermal denaturation
experiments on 3' and dsLS permit us to assign the observed Tm at 80 °C to the dissociation of
the double-stranded portion of dsLS, the Tm at 50 °C to 3', and the Tm at 15 °C to the relatively
shorter sticky-end overhangs connecting the linking strands to their respective rungs. DNA
vert distance 2.985 nm
vert distance 2.951 nm
vert distance 3.587 nm
vert distance 3.589 nm
a
b
Figure S8 Height analysis of 3nt and 4nt. Cross-sectional analysis of 3nt and 4nt reveals a consistent height of 2.95 nm and 3.56 nm for each respective DNA nanotube. The relative height ratio between 3ntand 4nt is thus 0.83.
© 2009 Macmillan Publishers Limited. All rights reserved.
nature nanotechnology | www.nature.com/naturenanotechnology 13
supplementary informationdoi: 10.1038/nnano.2009.72
S11
the 3nt and 4nt using the height images is consistently found to be 2.95 nm and 3.56 nm for all
nanotubes measured, which translates into a diameter ratio of 3nt to 4nt of 0.83 (Figure S8). This
value is in good agreement with the theoretically calculated value of 0.81, and can be used to
indirectly confirm the formation of triangular and square DNA nanotubes of the expected size.
To determine the thermal stability of our DNA nanotubes, thermal denaturation
experiments are conducted on the assembled triangular DNA nanotube 3nt, on the triangular rung
3', and on the double-stranded linking strands dsLS used to generate the final assembly. As seen
in Fig. S9, 3nt possesses three distinct melting ranges. Individual thermal denaturation
experiments on 3' and dsLS permit us to assign the observed Tm at 80 °C to the dissociation of
the double-stranded portion of dsLS, the Tm at 50 °C to 3', and the Tm at 15 °C to the relatively
shorter sticky-end overhangs connecting the linking strands to their respective rungs. DNA
vert distance 2.985 nm
vert distance 2.951 nm
vert distance 3.587 nm
vert distance 3.589 nm
a
b
Figure S8 Height analysis of 3nt and 4nt. Cross-sectional analysis of 3nt and 4nt reveals a consistent height of 2.95 nm and 3.56 nm for each respective DNA nanotube. The relative height ratio between 3ntand 4nt is thus 0.83.
S12
nanotubes 3nt are thus stable at temperature below 15 °C. In principle, the thermal stability of our
DNA nanotubes can be increased to values that are well above room temperature by incorporating
longer sticky-end overhangs connecting each rung to its respective linking strands.
VI. Assembly of triangular DNA nanotubes with radially protruding hairpins 3nt-hp
Hairpins are incorporated into the triangular-shaped DNA nanotubes to aid in their
characterization. In this case, the well-defined triangular rung 3'-hp is constructed using
rigidifying strands with protruding hairpins RS-hp to generate an assembly with three hairpins at
each of its corner units (Scheme S3). The sequences of the modified RS-hp strands are
summarized in Scheme S3; the hairpins are colored in dark purple for clarity. The assembly of a
triangular-shaped DNA nanotube 3nt-hp from this set of modified rungs results in one-
Scheme S3 Construction of 3'-hp using RS-hp.
RS-hp1 - TTCAACCTAAGACATCACCTTTGGGTGATGTCCAGCAAACCT RS-hp2 - GCAATACTATGACATCACCTTTTGGTGATGTCCAAGAGTTCC RS-hp3 - TTCCTACCTTGACATCACCTTTTGGTGATGTCGAGATGTCGT
a b3nt
3' dsLS
Sticky-end overhangs
3'
dsLS
Figure S9 (a) Thermal denaturation profile of 3nt reveals three distinct melting regions: the first is assigned to sticky-end overhangs connecting dsLS to their respective rungs 3', the second is assigned to 3', and the third is assigned to dsLS. (b) Thermal denaturation profile of 3' and dsLS.
© 2009 Macmillan Publishers Limited. All rights reserved.
14 nature nanotechnology | www.nature.com/naturenanotechnology
supplementary information doi: 10.1038/nnano.2009.72
S13
dimensional DNA nanotubes extending over tens of microns (Fig. S10a), with a protruding
periodicity at the nanoscale (Fig. S10b). Fourier analysis of the height-trace shows these
assemblies to possess a periodicity of 45 nm (Fig. S10c), which exactly corresponds to the
distance between three rungs within the nanotube assembly.
Figure S10 AFM characterization of 3nt-hp. (a) AFM analysis of 3nt-hp reveals the formation of extended 1D DNA nanotube assemblies (b) that possess detectable protrusions. Bar is 1 μm. (c) Fourier analysis of the height trace reveals a fundamental frequency (i.e. first harmonic) of 9.15. Given that each 15 pixels correspond to 45 nm, this translates into an experimentally calculated periodicity of 43 nm.
10 20 30 40 50 60
First harmonic
Second harmonic
50 100 150 0Distance (pixels)
a
b
c
45 nm
© 2009 Macmillan Publishers Limited. All rights reserved.
nature nanotechnology | www.nature.com/naturenanotechnology 15
supplementary informationdoi: 10.1038/nnano.2009.72
S13
dimensional DNA nanotubes extending over tens of microns (Fig. S10a), with a protruding
periodicity at the nanoscale (Fig. S10b). Fourier analysis of the height-trace shows these
assemblies to possess a periodicity of 45 nm (Fig. S10c), which exactly corresponds to the
distance between three rungs within the nanotube assembly.
Figure S10 AFM characterization of 3nt-hp. (a) AFM analysis of 3nt-hp reveals the formation of extended 1D DNA nanotube assemblies (b) that possess detectable protrusions. Bar is 1 μm. (c) Fourier analysis of the height trace reveals a fundamental frequency (i.e. first harmonic) of 9.15. Given that each 15 pixels correspond to 45 nm, this translates into an experimentally calculated periodicity of 43 nm.
10 20 30 40 50 60
First harmonic
Second harmonic
50 100 150 0Distance (pixels)
a
b
c
45 nm
S14
Although cross-sectional height analysis of the AFM images obtained from 3nt-hp reveal a
periodicity of 45 nm, no periodicity is observed when images from DNA nanotubes 3nt or 4nt
are analyzed. Furthermore, the effect of inward bowing on the morphology of our DNA
architectures, as determined via simple molecular modeling experiments on a three-tier triangular
DNA nanotube, reveals an inward dip of 2.8 nm upon a twist of 40° per rung (Fig. S11),
which in principle should be detectable by AFM. Given that no periodicity is observed for either
3nt or 4nt, we therefore cannot preclude the possibility that the incorporation of hairpins induces
twisting within 3nt-hp.
VII. Assembly of partially single-stranded square-shaped DNA nanotubes 4nt-ss
The approach to DNA nanotube construction presented in this contribution is amenable to the
generation of DNA nanotubes that can also exist in a partially single-stranded and open state. An
open square-shaped DNA nanotube is constructed using well-defined square rungs 4', one
double-stranded liking strands, and three single-stranded linking strands. As expected, AFM
analysis of these nanotubes shows them all to be more flexible when compared to their fully
double stranded analogue (Fig. S12). The fully double-stranded square DNA nanotubes 4nt are
rigid over distances that are greater than those obtained using the partially single-stranded open
square nanotubes.
2.8 nm
Figure S11 Molecular modeling on a three-tiered nanotube assembly reveals a central dip of 2.8 nm upon twisting. (AMBER force field calculations)
© 2009 Macmillan Publishers Limited. All rights reserved.
16 nature nanotechnology | www.nature.com/naturenanotechnology
supplementary information doi: 10.1038/nnano.2009.72
S15
VIII. Confocal fluorescence microscopy imaging of 3nt
Cover-slip and chamber preparation: In order to prevent any unwanted DNA-surface interactions
microscope glass-coverslips were functionalized using poly(vinylpyrrolidone) according to a
previously reported procedure (Rothemund et alS3). Glass-coverslips were soaked in a 1 M
sodium hydroxide solution (1 hour), rinsed with de-ionized (DI) water, immersed in a 1% v/v
acetic acid solution (2 hours), rinsed with DI water, and finally silanized using 3-
(trimethoxysilyl)propylmethacrylate (1% v/v) in acetic acid (1% v/v) for 36 hours. In a
Figure S12 AFM characterization of 4nt-ss. (a) AFM analysis of 4nt-ss reveals the formation of extended DNA nanotubes that are relatively more flexible than their fully double-stranded analogous 4nt.(b) Cross-sectional analysis of these assemblies shows them all to be of the same size. Bar is 5 μm.
b
a
S16
subsequent step glass-coverslips were functionalized with poly(vinylpyrrolidone) (PVP, Mw =
360,000). Herein, 500 mL of a 4% w/v poly(vinylpyrrolidone) (PVP) solution were mixed with
2.5 mL of 10% w/v ammonium persulfate solution and 250 μL of N,N,N0,N0
tetramethylethylenediamine (TEMED, Acros). Glass-coverslips were incubated in the PVP
solution at 80 °C for 18 hours, then rinsed and stored in DI water until further use. Immediately
prior to use, two PVP-coated glass-coverslips were rinsed with ethanol and dried. 9 μL of a
solution containing 260 nM DNA (DNA in strand concentration) and 65 μM Picogreen
(Molecular probes) in 40 mM Tris, 20 mM acetic acid, 2 mM EDTA and 12.5 mM MgCl2
(pH=7.8 buffer) were deposited onto one slide and covered by a second one. The DNA solution
was drawn under the capillary forces created by the two slides.
Experimental setup: The imaging setup has been described previouslyS4. The samples were
imaged using a stage-scanning confocal microscope setup. It consisted of a closed-loop sample
scanning stage model Nano LP100, Mad City Labs, (Madison, WI). Continuous circularly
polarized wave excitation at 488 nm (0.407 μW/μm2) from an Ar+ laser model 35 LAL 030 (from
Melles Griot) was introduced via an optical fiber and directed by a dichroic beamsplitter (z488rdc
DCLP, Chroma, Rockingham, VT) to the sample via a high numerical aperture (N.A.) = 1.40 oil
immersion microscope objective (Olympus U PLAN SAPO 100X). Fluorescence emission from
the sample was collected by the objective and directed, through an HQ535/50 emission filter, to
an avalanche photodiode detector (Perkin Elmer Optoelectronics SPCM AQR-14, Vaudreuil,
Quebec, Canada). Images consisting of 256 x 256 pixels were acquired by collecting the intensity
during 1 ms at each pixel. A home built LabView (National Instruments, Austin, TX) routine was
used for the data acquisition and the stage positioning. A National Instruments NI-PCI- 6602
board was used as a counter board.
Images (Fig. S13 and S14): Picogreen-stained DNA nanotubes were imaged using a stage
scanning confocal microscope. Stiff DNA nanotubes approximately 10 μm in length and 350 nm
in diameter (diffraction-limited resolution) were observed. Some nanotubes showed discontinuity
which could be attributed to an uneven staining. Picogreen solution without DNA-nanotubes
showed no longitudinal patterns but bright spots ca. 400 nm in diameter (i.e., diffraction-limited
spots) were however observed which may be attributed to impurities in the sample.
© 2009 Macmillan Publishers Limited. All rights reserved.
nature nanotechnology | www.nature.com/naturenanotechnology 17
supplementary informationdoi: 10.1038/nnano.2009.72
S15
VIII. Confocal fluorescence microscopy imaging of 3nt
Cover-slip and chamber preparation: In order to prevent any unwanted DNA-surface interactions
microscope glass-coverslips were functionalized using poly(vinylpyrrolidone) according to a
previously reported procedure (Rothemund et alS3). Glass-coverslips were soaked in a 1 M
sodium hydroxide solution (1 hour), rinsed with de-ionized (DI) water, immersed in a 1% v/v
acetic acid solution (2 hours), rinsed with DI water, and finally silanized using 3-
(trimethoxysilyl)propylmethacrylate (1% v/v) in acetic acid (1% v/v) for 36 hours. In a
Figure S12 AFM characterization of 4nt-ss. (a) AFM analysis of 4nt-ss reveals the formation of extended DNA nanotubes that are relatively more flexible than their fully double-stranded analogous 4nt.(b) Cross-sectional analysis of these assemblies shows them all to be of the same size. Bar is 5 μm.
b
a
S16
subsequent step glass-coverslips were functionalized with poly(vinylpyrrolidone) (PVP, Mw =
360,000). Herein, 500 mL of a 4% w/v poly(vinylpyrrolidone) (PVP) solution were mixed with
2.5 mL of 10% w/v ammonium persulfate solution and 250 μL of N,N,N0,N0
tetramethylethylenediamine (TEMED, Acros). Glass-coverslips were incubated in the PVP
solution at 80 °C for 18 hours, then rinsed and stored in DI water until further use. Immediately
prior to use, two PVP-coated glass-coverslips were rinsed with ethanol and dried. 9 μL of a
solution containing 260 nM DNA (DNA in strand concentration) and 65 μM Picogreen
(Molecular probes) in 40 mM Tris, 20 mM acetic acid, 2 mM EDTA and 12.5 mM MgCl2
(pH=7.8 buffer) were deposited onto one slide and covered by a second one. The DNA solution
was drawn under the capillary forces created by the two slides.
Experimental setup: The imaging setup has been described previouslyS4. The samples were
imaged using a stage-scanning confocal microscope setup. It consisted of a closed-loop sample
scanning stage model Nano LP100, Mad City Labs, (Madison, WI). Continuous circularly
polarized wave excitation at 488 nm (0.407 μW/μm2) from an Ar+ laser model 35 LAL 030 (from
Melles Griot) was introduced via an optical fiber and directed by a dichroic beamsplitter (z488rdc
DCLP, Chroma, Rockingham, VT) to the sample via a high numerical aperture (N.A.) = 1.40 oil
immersion microscope objective (Olympus U PLAN SAPO 100X). Fluorescence emission from
the sample was collected by the objective and directed, through an HQ535/50 emission filter, to
an avalanche photodiode detector (Perkin Elmer Optoelectronics SPCM AQR-14, Vaudreuil,
Quebec, Canada). Images consisting of 256 x 256 pixels were acquired by collecting the intensity
during 1 ms at each pixel. A home built LabView (National Instruments, Austin, TX) routine was
used for the data acquisition and the stage positioning. A National Instruments NI-PCI- 6602
board was used as a counter board.
Images (Fig. S13 and S14): Picogreen-stained DNA nanotubes were imaged using a stage
scanning confocal microscope. Stiff DNA nanotubes approximately 10 μm in length and 350 nm
in diameter (diffraction-limited resolution) were observed. Some nanotubes showed discontinuity
which could be attributed to an uneven staining. Picogreen solution without DNA-nanotubes
showed no longitudinal patterns but bright spots ca. 400 nm in diameter (i.e., diffraction-limited
spots) were however observed which may be attributed to impurities in the sample.
© 2009 Macmillan Publishers Limited. All rights reserved.
18 nature nanotechnology | www.nature.com/naturenanotechnology
supplementary information doi: 10.1038/nnano.2009.72
S17
Figure S13 Fluorescence intensity images obtained for picogreen-stained DNA-nanotubes upon 488 nm excitation. 9 μL of a solution containing 260 nM DNA (DNA in strand concentration) and 65 μM Picogreen was deposited onto one slide and covered by a second one.
Figure S14 Control fluorescence intensity images obtained with picogreen upon 488 nm excitation. 9 μL of a solution containing 65 μM Picogreen was deposited onto one slide and covered by a second one.
© 2009 Macmillan Publishers Limited. All rights reserved.
nature nanotechnology | www.nature.com/naturenanotechnology 19
supplementary informationdoi: 10.1038/nnano.2009.72
S17
Figure S13 Fluorescence intensity images obtained for picogreen-stained DNA-nanotubes upon 488 nm excitation. 9 μL of a solution containing 260 nM DNA (DNA in strand concentration) and 65 μM Picogreen was deposited onto one slide and covered by a second one.
Figure S14 Control fluorescence intensity images obtained with picogreen upon 488 nm excitation. 9 μL of a solution containing 65 μM Picogreen was deposited onto one slide and covered by a second one.
S18
IX. Atomic force microscopy
AFM sample preparation typically involves the deposition of 10 μL of the self-assembled mixture
(concentration of 10 pM) onto freshly cleaved mica (dimensions 2 X 2 cm), followed by adequate
evaporation to achieve complete dryness (typically 30 mins in a fumehood). Whenever possible,
imaging is conducted within 24 hours to minimize time-dependant sample degradation. AFM
images are acquired in air, and at room temperature. “Tapping mode” (i.e. intermittent contact
imaging) is performed at a scan rate of 1 Hz using etched silicon cantilevers with a resonance
frequency of ~ 300 kHz, a spring constant of ~ 42 N/m, and a tip radius of < 10 nm. All images
are acquired with medium tip oscillation damping (20-30%).
X. References
S1. See references 12, 13 and 14 in manuscript.
S2. Carriero, S. & Damha, M. J. Synthesis of lariat-DNA via the chemical ligation of a
dumbbell complex. Org. Lett. 5, 273-276 (2003).
S3 Rothemund, P. W. K. et al. Design and characterization of programmable DNA
nanotubes. J. Am. Chem. Soc. 126, 16344-16352 (2004).
S4 Ngo, A. T., Karam, P., Fuller, E., Burger, M. & Cosa, G. Liposome encapsulation
of conjugated polyelectrolytes: toward a liposome beacon. J. Am. Chem. Soc. 130,
457-459 (2008).
© 2009 Macmillan Publishers Limited. All rights reserved.