2009 incourse v22061715.pdf

8/14/2019 2009 INCOURSE v22061715.pdf

1/25

THE UNIVERSITY OF AUCKLAND

INCOURSE TEST 2009

BIOLOGICAL SCIENCES

BIOSCI 101 FC

Essential Biology

Thursday 23 April 2009 6.30 - 8.30pm

(Time Allowed: TWO hours)

VERSION 22061715Student Identication Form

PLEASE COMPLETE THE FOLLOWING:

Family Name: _______________________________________________

First Name: _______________________________________________

ID Number: _______________________________________________

Signature: _______________________________________________

Submit this page to supervisors at the beginning of the test.

(Failure to do this may result in non-assessment of your script!)

8/14/2019 2009 INCOURSE v22061715.pdf

2/25

BIOSCI 101 FC


BIOLOGICAL SCIENCES

Essential Biology

In-course Assessment Test

Thursday 23 April 2009 6.30 - 8.30pm

GENERAL INSTRUCTIONS

Short Answers: Print your name and I.D. at the top of EVERY ANSWER PAGE. Record your answers in spaces provided.

All questions must be attempted.

Multiple Choice Questions:

Use the pink Scantron Answer Sheet.

Use pencilsonly. Shade the rectangle completely.

Do not X out mistakes. ERASE them completely.

Complete Family name, initials (under rst name),

ID Number. Fill spaces from left to right.

Enter Code (=version number) in box headed Version Code.Your code is 22061715. Failure to enter this code willmean MCQs cannot be marked.

Test Format: TOTAL 100 MARKS

ALL QUESTIONS MUST BE ATTEMPTED.

Multiple choice Questions

Section A: Cellular & Molecular Biology 25 marks

Section B: Microbiology 8 marks

Section C: Genetics 20 marks

Short Answers

Section D: Cellular & Molecular Biology 22 marks

Section E: Microbiology 9 marks

Section F: Genetics 16 marks

Hand in the scantron answer sheet and short answer sheets (Sections D, E and F)

Retain your multiple choice question pages

8/14/2019 2009 INCOURSE v22061715.pdf

3/25

VERSION 22061715 1 BIOSCI 101 FC

CONTINUED

SECTION A

CELLULAR & MOLECULAR BIOLOGY

MULTIPLE CHOICE QUESTIONS

TEST VERSION CODE: 2206171525 marks Recommended time 29 minutes

Choose the ONE correct answer from the alternatives provided.

Question 1: Which of the following statements concerning prokaryotic and eukaryotic cells

isincorrect?

1. Prokaryotic cells lack a membrane-bound nucleus.

2. DNA is present in both prokaryotic cells and eukaryotic cells.

3. Prokaryotic cells contain small membrane-enclosed organelles.

4. Eukaryotic cells contain a membrane-bound nucleus.

5. DNA is present in the nucleus of eukaryotic cells.

Question 2: Figure 1 represents a cellular organelle which has been visualised by

microscopy. The name of the organelle and the technique most likely to have

been used is: 1. mitochondrion ; scanning electron microscopy

2. mitochondrion: transmission electron microscopy

3. lysosome ; freeze fracturing

4. nucleus ; light microscopy

5. chloroplast ; transmission electron microscopy

Question 3: If the scale bar on Figure 1 represents 100nm, the approximate width of the

organelle is:

1. 800 mm

2. 0.8 m3. 8 m

4. 0.8 m

5. 80 nm

Figure 1

8/14/2019 2009 INCOURSE v22061715.pdf

4/25


CONTINUED

Question 4: Which of the following is nota polymer?

1. DNA

2. starch

3. glucose

4. chitin

5. cellulose

Question 5: In Figure 2 above, the bond closest to the carboxyl end of the molecule is:

1. Bond C

2. Bond B

3. Bond A

4. Bond E

5. Bond D

Question 6: Which of the following molecules store and transmit hereditary information?

1. proteins

2. fats

3. carbohydrates4. lipids

5. nucleic acids

Question 7: How many molecules of water are needed to completely hydrolyse a polymer

that is 11 monomers long?

1. 11

2. 12

3. 8

4. 9

5. 10

Question 8: Which type of interaction stabilises the alpha () helix and the beta () pleatedsheet structures of proteins?

1. peptide bonds

2. hydrophobic interactions

3. hydrogen bonds

4. nonpolar covalent bonds

5. ionic bonds

Question 9: All of the following contain amino acids except:

1. insulin.

2. DNA polymerase.

3. haemoglobin.

4. cholesterol.

5. enzymes.

Figure 2

8/14/2019 2009 INCOURSE v22061715.pdf

5/25


CONTINUED

Question 10: If a DNA sample were composed of 10% thymine, what would be the

percentage of guanine?

1. 20

2. 80

3. 10

4. it is impossible to tell from the information given5. 40

Question 11: The organelle in which light energy may be converted to chemical energy is the:

1. mitochondrion

2. Golgi body

3. chloroplast

4. lysosome

5. nucleus

Question 12: Which of the following is a reasonable explanation for why unsaturated fatty

acids help keep membranes more fluid at lower temperatures?

1. The double bonds block interaction among the hydrophilic head groups of

the lipids.

2. The double bonds result in shorter fatty acid tails and thinner membranes.

3. The double bonds form kinks in the fatty acid tails, forcing adjacent lipids

to be further apart.

4. Unsaturated fatty acids have a high cholesterol content.

5. Unsaturated fatty acids permit more water in the interior of the

membrane.

Figure 3

Question 13: In Figure 3, the structure labeled D is:

1. the cytoskeleton

2. an integral membrane protein

3. a peripheral membrane protein

4. a glycoprotein

5. cholesterol

8/14/2019 2009 INCOURSE v22061715.pdf

6/25


CONTINUED

Question 14: What kinds of molecules pass through a cell membrane most easily?

1. large and hydrophobic

2. small and hydrophobic

3. monosaccharides such as glucose

4. large and polar5. ionic

Question 15: Substance A diffuses very slowly through artificial phospholipid bilayers. In the

cells lining the small intestine however, substance A moves rapidly from food

in the gut into the cytoplasm of the intestinal cells where it is metabolised at a

fast rate. Using this information, which transport mechanism is most probably

functioning in the intestinal cells?

1. simple diffusion

2. exocytosis

3. phagocytosis

4. facilitated diffusion

5. active transport

Question 16: The junctions joining adjacent cells together as shown in Figure 4 are called:

1. plasmodesmata

2. flagellae

3. desmosomes

4. tight junctions

5. gap junctions

Question 17: Which of the following statements regarding enzymes is true?

1. The names of enzymes always end in ase.

2. Enzymes change the direction of chemical reactions.

3. Enzymes prevent changes in substrate concentrations.

4. Enzymes increase the rate of chemical reactions by lowering activation

energy barriers.

5. Enzymes are permanently altered by the reactions they catalyse.

Figure 4

8/14/2019 2009 INCOURSE v22061715.pdf

7/25


CONTINUED

Question 18: Why does the DNA double helix have a uniform diameter?

1. Deoxyribose sugars bind with ribose sugars.

2. C nucleotides pair with A nucleotides.

3. Hydrophilic amino acids are arranged on the inside of the helix.

4. 5' phosphates bind with 3' hydroxyl groups.5. Purines pair with pyrimidines.

Question 19: In DNA replication the nucleotide sequence of the newly synthesised strand is

determined by:

1. the nucleotide sequence of the template strand.

2. the primase used in the reaction.

3. the particular DNA polymerase catalysing the reaction.

4. the relative amounts of the four nucleoside triphosphates in the cell.

5. the arrangement of histones in the sugar-phosphate backbone.

Question 20: What is the role of DNA ligase in the elongation of the lagging strand during

DNA replication?

1. stabilise the unwound parental DNA

2. unwind the parental double helix

3. join Okazaki fragments together

4. synthesise RNA nucleotides to make a primer

5. catalyse the synthesis of new DNA

Question 21: Which of the following statements is trueof chromatin?

1. Only euchromatin is visible under the light microscope.

2. Heterochromatin is composed of DNA, whereas euchromatin is made ofDNA and RNA.

3. Heterochromatin is highly condensed, whereas euchromatin is less

compact.

4. Euchromatin is found in eukaryotes whereas heterochromatin is found in

prokaryotes.

5. Both heterochromatin and euchromatin are found in the cytoplasm.

Question 22: Which of the following help(s) to stabilise mRNA by inhibiting its degradation?

1. RNA polymerase

2. the 5' cap and 3' poly (A) tail3. introns

4. promoter sequences

5. spliceosomes

Question 23: In both eukaryotes and prokaryotes, gene expression is primarily regulated at

the level of:

1. translation.

2. mRNA stability.

3. protein stability.

4. transcription.

5. mRNA splicing.

8/14/2019 2009 INCOURSE v22061715.pdf

8/25


CONTINUED

Question 24: At the 3'end of the tRNA shown in Figure 5:

1. An amino acid is attached by an aminoacyl tRNA synthetase

2. The 5' cap of the mRNA will become covalently bound.3. The codon and anticodon complement one another.

4. The small and large subunits of the ribosome attach.

5. The excess nucleotides (ACCA) are cleaved off to produce a mature

tRNA molecule.

Question 25: What is the most abundant type of RNA in a normal eukaryotic cell?

1. pre-mRNA

2. dsRNA

3. mRNA

4. tRNA5. rRNA

Figure 5

8/14/2019 2009 INCOURSE v22061715.pdf

9/25


CONTINUED

SECTION B

MICROBIOLOGY


8 marks Recommended time 10 minutes


Question 26: The host range of a virus is determined by

1. whether the viral nucleic acid is DNA or RNA.

2. the proteins in the cytoplasm of the host cell.

3. the enzymes carried by the virus.4. the enzymes produced by the virus before it infects the cell.

5. the proteins on its surface and that of the host.

Question 27: Which of the following statementscorrectlydescribes an event in the lysogenic

cycle of lambda (l ) phage?1. After infection, the viral genes immediately turn the host cell into a

lambda-producing factory, and the host cell then lyses.

2. The phage DNA is incorporated by homologous recombination into any

nonspecific site on the host cell's DNA.

3. Most of the prophage genes are transcribed but not translated4. Certain environmental triggers can cause the phage to exit the host

genome, switching from the lytic to the lysogenic cycle.

5. The phage genome replicates along with the host genome.

Question 28: After mixing a heat-killed, phosphorescent strain of bacteria with a living,

non-phosphorescent strain, you discover that some of the living cells are now

phosphorescent. The most likely explanation for this change is:

1. A retrovirus has infected the living strain.

2. The genes controlling phosphorescence have been switched off by a

repressor.

3. DNA passed from the heat-killed strain to the living strain.

4. Protein passed from the living strain to the heat-killed strain.

5. Multiple mutations have occurred in cells of the living strain.

Question 29: The genes for sex pilus construction and for tetracycline resistance are found

to be located together on the same plasmid within a particular bacterium.

Tetracycline resistance could spread rapidly from this bacterium to others by the

process of:

1. meiosis

2. transformation

3. conjugation4. transduction

5. mutation

8/14/2019 2009 INCOURSE v22061715.pdf

10/25


CONTINUED

Question 30: Which of the following statements about the genomes of prokaryotes is

incorrect:

1. the prokaryotic chromosome is circular.2. replication of the prokaryotic chromosome begins at multiple origins of

replication.

3. mutations are a significant source of genetic diversity.

4. additional genetic information may be carried on plasmids.

5. genes coding for proteins with related functions may be grouped as

operons.

Figure 6 depicts changes to the amount of DNA present in a recipient cell that is engaged inconjugation with anHfrcell. DNA from theHfrcell begins entering the recipient cell at Time A.

Assume that a fragment of the recipients chromosome is exchanged for a homologous fragment

from theHfrcells DNA.

Use Figure 6 to answer the following question.

Question 31: What is occurring at Time C that is decreasing the DNA content?

1. homologous recombination

2. degradation of DNA that was not integrated into the recipients

chromosome

3. reversal of the direction of conjugation

4. DNA replication

5. meiosis

Question 32: The regulatory gene of an operon codes for:

1. a promoter

2. a repressor

3. a cofactor4. an inducer

5. an operator

Figure 6

8/14/2019 2009 INCOURSE v22061715.pdf

11/25


CONTINUED

SECTION C

GENETICS


20 marks Recommended time 21 minutes


Question 33: In the absence of glucose, lactose induces transcription of the genes of the lac

operon by binding to:

1. the repressor

2. the operator

3. the promoter

4. -galactosidase

5. RNA polymerase

Question 34: Which of the following statements is incorrect?

1. Genes are evenly distributed across the different human chromosomes.

2. The human genome is approximately 3 billion base pairs in length.

3. Each human chromosome comprises just one piece of ds DNA.

4. The human genome is made up of a total of 46 chromosomes.5. The sequencing of the human genome was only made possible by

advances in recombinant DNA technology.

Question 35: The human genome consists of approximately:

1. 200,000 - 250,000 genes.

2. 200 - 250 genes.

3. 20,000 - 25,000 genes.

4. 2,000 -2,500 genes.

5. 20 -25 genes.

Question 36: What is the enzymatic function of restriction enzymes?

1. To repair breaks in sugar-phosphate backbones.

2. To join nucleotides during transcription.

3. To cleave nucleic acids at specific sites.

4. To add new nucleotides to the growing strand of DNA.

5. To join nucleotides during replication.

Question 37: The DNA fragments making up a genomic library are generally contained in:

1. radioactive eukaryotic cells.

2. recombinant plasmids of bacteria.

3. individual wells.

4. DNA-RNA hybrids.

5. recombinant viral RNA.

8/14/2019 2009 INCOURSE v22061715.pdf

12/25


CONTINUED

Question 38: A student wishes to clone a sequence of DNA of ~10,000 base pairs. Which

vector would be appropriate?

1. a bacteriophage such as l2. a YAC

3. a plasmid4. a plant virus

5. a large polypeptide

Question 39: Which of the following is used to make complementary DNA (cDNA) from

RNA?

1. gene cloning

2. gel electrophoresis

3. restriction enzymes

4. reverse transcriptase

5. DNA ligase

Question 40: Asexual reproduction results in genetically identical offspring unless which of

the following occurs?

1. Mutation

2. Cloning

3. Environmental change

4. Natural selection

5. Crossing over

Question 41: After telophase I of meiosis, the chromosomal makeup of each daughter cell is:

1. haploid, and the chromosomes are each composed of two chromatids.

2. tetraploid, and the chromosomes are each composed of two chromatids.

3. haploid, and the chromosomes are each composed of a single chromatid.

4. diploid, and the chromosomes are each composed of two chromatids.

5. diploid, and the chromosomes are each composed of a single chromatid.

Question 42: How do cells at the completion of meiosis compare with cells that have

replicated their DNA and are just about to begin meiosis?

1. They have half the number of chromosomes and one-fourth the amount of

DNA.

2. They have twice the amount of cytoplasm and half the amount of DNA.3. They have the same number of chromosomes and half the amount of

DNA.

4. They have half the amount of cytoplasm and twice the amount of DNA.

5. They have half the number of chromosomes and half the amount of DNA.

Question 43: During meiosis, tetrads of chromosomes are aligned at the equator of the

spindle. Alignment determines independent assortment. At what stage in meiosis

does this occur?

1. Prophase II

2. Anaphase II3. Metaphase I

4. Anaphase I

5. Prophase

8/14/2019 2009 INCOURSE v22061715.pdf

13/25


CONTINUED

Question 44: If both children are of blood group MM, which of the following is possible?

1. Both children are heterozygous for this gene.

2. The MN blood group is recessive to the ABO blood group.

3. Each parent is either M or MN.

4. Neither parent can have the N allele.5. Each parent must be type M.

Question 45: Which of the following terms best describes when the phenotype of the

heterozygote differs from the phenotypes of both homozygotes?

1. complete dominance

2. pleiotropy

3. epistasis

4. incomplete dominance

5. multiple alleles

Question 46: Most genes have many more than two alleles. However, which of the following

is also true?

1. All of the alleles but one will produce harmful effects if homozygous.

2. Most of the alleles will never be found in a live-born organism.

3. The trait may still have only two phenotypes.

4. More than two alleles in a genotype is lethal.

5. At least one allele for a gene always produces a dominant phenotype.

Question 47: A pedigree analysis for the occurrence of a given disorder in a family shows

that, although both parents of an affected child are normal, each of the parentshas relatives affected with the same condition. The disorder is:

1. a new mutation

2. dominant

3. incompletely dominant

4. recessive

5. maternally inherited

Question 48: T.H Morgan and Sturtevant provided genetic evidence for the existence of four

pairs of chromosomes inDrosophilain which of these ways?

1. Drosophilagenes have, on average, four different alleles.

2. The overall number of genes inDrosophilais a multiple of four.3. The entireDrosophilagenome has approximately 400 map units.

4. There are four major functional classes of genes inDrosophila.

5. Drosophilagenes cluster into four distinct groups of linked genes.

Question 49: Cinnabar eyes is a sex-linked recessive characteristic in fruit flies. If a female

having cinnabar eyes is crossed with a wild-type male, what percentage of the

F1 males will have cinnabar eyes?

1. 100%

2. 75%

3. 0%4. 50%

5. 25%

8/14/2019 2009 INCOURSE v22061715.pdf

14/25


CONTINUED

The following is a map of four genes on a chromosome:

Question 50: Between which two genes would you expect the highest frequency of

recombination?

1. W and E

2. A and G

3. A and W

4. E and G

5. A and E

Question 51: The human X and Y chromosomes:

1. include genes that determine an individuals sex.

2. are almost entirely homologous, despite their different names.

3. include only genes that govern sex determination.

4. are of approximately equal size and number of genes.

5. are both present in every somatic cell of males and females alike.

Question 52: SRY is best described in which of the following ways?1. An autosomal gene that is required for the expression of genes on the X

chromosome

2. An autosomal gene that is required for the expression of genes on the Y

chromosome

3. Males or females lacking the gene do not survive past early childhood

4. A gene region present on the Y chromosome that triggers male

development

5. A gene present on the X chromosome that triggers female development

Question 53: A man with Klinefelter syndrome (47, XXY) is NOTexpected to have:1. long limbs.

2. lower sperm count.

3. possible breast enlargement.

4. female body characteristics.

5. increased testosterone.

QUESTION/ANSWER SHEETS FOLLOW

8/14/2019 2009 INCOURSE v22061715.pdf

15/25


CONTINUED


In-Course Test 2009

BIOSCI 101

Essential Biology

Short Answer Questions Section

Instructions

Print your name and ID in the space above

Print your name and ID at the top of each answer page.

Record your answers in the spaces provided. Only answers in the specied areas will bemarked.

All questions should be attempted.

Short Answer Format

Section D: Cellular & Molecular Biology 22 marks

Section E: Microbiology 9 marks

Section F: Genetics 16 marks

Total: 47 marks. Recommended time: 1 hour.

C&MB

Section D

Micro

Section E

Genetics

Section F

Admin Use Only

22 9 16

Family name: ________________________________________________

First name: ________________________________________________

Student ID Number: __________________________

8/14/2019 2009 INCOURSE v22061715.pdf

16/25


CONTINUED

SECTION D

CELLULAR & MOLECULAR BIOLOGY

SHORT ANSWER QUESTIONS

22 marks

Recommended time 30 minutes

FIRST NAME: ................................. FAMILY NAME: .......................................................

ID NO: ......................................................

For ofcial use

Use this diagram and your knowledge of enzyme catalysis to answer the following questions.

54. Label the following features on Figure 7:

(i) the substrates of the first reaction of the pathway

(ii) the final product of the pathway

(iii) the active site of the first enzyme in the pathway (3 marks)

55. Typically the active site involves a small number of amino acids that make up the enzyme.What part of these amino acids would actually interact with the substrate(s)? (1 mark)

________________________________________________________________________

56. The first enzyme in this pathway is allosteric. Define this term and label the allosteric

site on the enzyme (i.e. the region where the allosteric regulatory molecule binds to the

enzyme). (2 marks)

This diagram (Figure 7) represents

enzymes catalysing a series of reactions

in a metabolic pathway.

Total

6

Figure 7

8/14/2019 2009 INCOURSE v22061715.pdf

17/25


CONTINUED

57. Describe how an allosteric enzyme regulates a metabolic pathway. (2 marks)

58. Enzyme activity depends on factors such as pH and temperature. Sketch the activity curve

you would expect to see for an enzyme that catalyses reactions inside a vesicle with an

internal pH of 3.0. (1 mark)

3

8/14/2019 2009 INCOURSE v22061715.pdf

18/25


CONTINUED


ID NO: ......................................................

Use the codon table provided below to answer the following questions (you are not expected

to know the full names of the amino acids)

2

59. The following mRNA codes for the first few amino acids of a protein (the

initiation codon is in bold).

5'ACGCAGACCAUGCCCCGGAAUCCGUUUAGGCAAGUAAA3'

(i) Write the amino acid sequence for the first five codons translated by the ribosome

(1 mark)

_________________________________________________

(ii) Write the sequence (3' to 5') for the anticodon loop of the tRNA that brings in the

fifth amino acid. (1 mark)

_________________________________________________

#1

#2

8/14/2019 2009 INCOURSE v22061715.pdf

19/25


CONTINUED

59 cont.

Two different point mutations are found in the gene that codes for this protein. For each,

name the type of mutation and classify its effect on the protein as:

harmless

possibly serious

very likely to result in a non-functional protein.

(iii) the G at arrow#1 changes to a C

type of mutation: __________________________________________________

effect: ___________________________________________________________

(iv) the A at arrow#2 is deleted

type of mutation: __________________________________________________

effect: ___________________________________________________________

(4 marks)

60. The following statements describe events that happen during the initiation and elongation

phases of translation:

(a) an aminoacyl-tRNA binds to the A site

(b) a peptide bond forms between the new amino acid and the growing polypeptide

chain(c) the initiator tRNA binds to the start codon

(d) a small ribosomal subunit binds with mRNA

(e) tRNA translocates from the A site to the P site

(i) Arrange the letters (a-e) to show the correct sequence for these events. (1 mark)

_________________________________________________

(ii) Write three short statements that summarise the key events in the termination

phase of translation. (3 marks)

8

8/14/2019 2009 INCOURSE v22061715.pdf

20/25


CONTINUED

61. Using the following table, list three ways in which transcription and/or translation differ

between pro- and eukaryotic cells. (3 marks)

Prokaryote Eukaryote


ID NO: ......................................................

3

8/14/2019 2009 INCOURSE v22061715.pdf

21/25

8/14/2019 2009 INCOURSE v22061715.pdf

22/25


CONTINUED

64. A culture ofE. coliis growing in a mixture of glucose and lactose.

(i) sketch the growth curve you would expect to see for bacteria growing in these

conditions and indicate the point on your curve when the bacteria would begin to

metabolise the lactose. (2 marks)

(ii) explain the molecular events that must have happened for the bacteria to produceenzymes capable of metabolising lactose. (2 marks)

4

8/14/2019 2009 INCOURSE v22061715.pdf

23/25


CONTINUED

65 66 67 68 69 70 Total

For ofcial use

SECTION F

GENETICS

SHORT ANSWER QUESTIONS

16 marks

Recommended time 20 minutes

FIRST NAME: ................................. FAMILY NAME: ..........................................................

ID NO: ..........................................................

65. Explain the term biotechnology and give an example where genetic engineering has been

used to alter a commercial horticulture crop. (2 marks)

66. The table below is a comparison between genetic engineering and selective breeding.

Complete the table by lling in the missing information. (2 marks)

Genetic engineering Selective breeding

Precise choice of one or a few genes

Only genes from related species

Control of gene expression No control of gene expression

8/14/2019 2009 INCOURSE v22061715.pdf

24/25


CONTINUED

67. On the plasmid vector diagram below label the location of :

the promoter regions,

the inserted foreign gene,

the lacZ gene,

the antibiotic resistance gene,

and vector sequence. (3 marks)

(b) During which phase of meiosis does crossing over occur? (1 mark)

(c) What are the genetic consequences of crossing over? (2 marks)

68. In space provided below, answer the following questions about the process of

crossing over.

(a) Describe the process of crossing over. (1 mark)

8/14/2019 2009 INCOURSE v22061715.pdf

25/25


FIRST NAME: ................................. FAMILY NAME: ..........................................................

ID NO: ..........................................................

69. The phenotype is determined by a number of important factors.

(a) Complete the following sentence by lling in the missing words. (2 marks)

The phenotype is determined by _________________ between alleles of the same or

different genes, as well as by the ____________________.

(b) Dene the term developmental noise and give an example. (2 marks)

70. Barr bodies are densely stained objects in the nuclei of female cells and result from the

random inactivation of one of the female X chromosomes. Most Barr body genes are not

expressed.

In the space provided below explain why all female gametes (eggs) have a functional X

chromosome. (1 mark)

2009 incourse v22061715.pdf

Documents