2009-2buffalo bullrtin

International Buffalo Information Center

(IBIC)

Aims

IBIC is a specialized information center onwater buffalo. Established in 1981 by KasetsartUniversity (Thailand) with an initial financialsupport from the International DevelopmentResearch Center (IDRC) of Canada. IBIC aims atbeing the buffalo information center of buffaloresearch community through out the world.

Main Objectives

1. To be world source on buffalo information 2. To provide literature search and photocopy services 3. To disseminate information in newsletter 4. To publish occasional publications such as an inventory of ongoing research projects

BUFFALO BULLETINISSN : 0125-6726

Buffalo Bulletin is published quarterly in March,June, September and December. Contributions onany aspect of research or development, progressreports of projects and news on buffalo will beconsidered for publication in the bulletin. Manu-scripts must be written in English and follow theinstruction for authors which describe at inside ofthe back cover.

EditorS. Sophon

Publisher International Buffalo Information Centre, Main Library, Kasetsart University

Online availible:http://ibic.lib.ku.ac.th/e-Bulletin

BUFFALO BULLEITNIBIC, KASETSART UNIVERSITY, P.O. BOX 1084

BANGKOK 10903, THAILAND URL : http://ibic.lib.ku.ac.th E-mail : [email protected] Tel : 66-2-9428616 ext. 344 Fax : 66-2-9406688

Buffalo Bulletin (June 2009) Vol.28 No.2

51

INDUCTION OF ESTRUS IN TRUE ANESTRUS BUFFALOES USING CRESTAR IMPLANTSALONE AND IN COMBINATION WITH PMSG

Vivek Nayak, R.G. Agrawal, O.P. Srivastav and M.S. Thakur

Department of Animal Reproduction, Gynaecology and Obstetrics, College of Veterinary Science & A.H.,J.N.K.V.V. Jabalpur, India

ABSTRACT

This study was conducted on 32 trueanestrus buffaloes to see the efficacy of Crestarimplants alone and in combination with PMSG toinduce estrus and fertility. The animals wererandomly divided into four groups with eight animalsin each. Group 1 was implanted with Crestar for 9days whereas Groups 2 and 3 for 7 days with 2 mlinjection of Crestar solution on the day ofimplantation. PMSG 500 IU was also injected inGroup 3 on the day of implant removal. Group 4served as an untreated control. On removal ofimplant, all the buffaloes of Group 3 exhibited estruswith the mean duration of 2.75 ± 0.24 days withhighest (75 %) conception rate followed by 87.50and 75 % estrus response within 2.62 ± 0.46 and2.50 ± 0.73 days, with the conception rate of 71.42and 66.67 % in Groups 1 and 2, respectively. Noneof the animals of Group 4 showed estrus. Most ofthe buffaloes of Groups 1, 2 and 3 expressed intenseand intermediate estrus (50 vs. 33.33, 57.10 vs. 28.60and 37.50 vs. 37.50 %) with conception rates of100 vs. 50, 75 vs. 50 and 100 vs. 66.66 %,respectively. Most of the animals of Groups 1, 2and 3 showed good and satisfactory arborizationpatterns (50 vs. 33.33, 42.86 vs. 42.86, and 50 vs.37.50 %) with conception rates of 100 vs. 50, 100vs. 66.67 and 75 vs. 100 %, respectively. None ofthe animals missing arborization pattern conceived.It was concluded that better conception rates canbe obtained when animals are bred during intense(standing) estrus with good to satisfactoryarborization patterns of cervico- vaginal mucus.

Keywords: crestar implant, PMSG, estrus induction,fertility, arborization

INTRODUCTION

Anoestrus due to ovarian inactivity isconsidered to be the most important, frustrating, andchallenging problem associated with buffaloreproduction in India. It is the main cause of loweredfertility in buffaloes and is responsible fortremendous economic losses to the farmers bydecreasing milk yield and the number of calvesproduced in a cow’s lifetime. True anestrus is thecondition in which both the ovaries are small, smooth,inactive with the absence of Graffian follicle orcorpus luteum and characterized by cessation ofsexual cycle and psychic manifestation of estrus.Higher incidence of anestrus due to inactive ovariesin buffalo than in cow has been reported by Tanwaret al. (2003). Various hormonal treatments likeGnRH, estrogen and progesterone either alone or incombination have been tried with variable success(Rao and Rao, 1984 and Singh et al., 2004). Keepingall this in view, the present study was undertaken ontrue anestrus buffaloes to see the efficacy of Crestarimplants alone and in combination with PMSG inrelation to estrus response and fertility.

MATERIALS AND METHODS

The present study was conducted on 32 trueanestrus buffaloes aged between 5 and 10 yearsbelonging to the Livestock Farm Adhartal and toprivate dairies in Jabalpur, November 2005 to April2006. The animals which did not express estrus for


52

4 to 8 months were examined gynaeco-clinically, andthose having inactive ovaries with no cyclic activitywere considered as “true anestrus”. These animalswere randomly distributed into four groups of eightanimals and the treatments given were as in Table1.

Estrus was detected by parading a breedingbull followed by observing behavior symptoms andconfirmed by rectal examination of genitalia. Animalshowing estrus were allowed natural service. Estrusintensity was recorded as intense (standing),intermediate and weak. The arborization patternsof cervico-vaginal mucus (CVM) were observedunder low power (10x) and classified as good,satisfactory and unsatisfactory (missing) as perHafez (2000). The buffaloes of all the groups wereexamined gynaeco-clinically on the 12th day postservice for the presence of corpus luteum.Pregnancy was confirmed per-rectally 50 days afterbreeding. The fertility response to the differenttreatment regimens was evaluated in relation to theintensity of estrus and the arborization pattern.

RESULTS AND DISSCUSSION

On removal of implants, all the buffaloes ofGroup 3 exhibited estrus with the mean duration of2.75 ± 0.24 days with highest (75 %) conceptionrate; in Groups 1 and 2, there were 87.50 and 75 %estrus responses within 2.62 ± 0.46 and 2.50 ± 0.73days, and conception rates of 71.42 and 66.67 %,respectively, wheras, none of the animals of Group4 showed estrus. The present findings are in closeagreement with the findings of Agrawal et al. (1999),who reported 71.42 percent estrus response in trueanestrus cows. Similarly, Chhatry (1998) observedan 80 % estrus response within 62.8 ± 8.70 h with70 % conception in buffaloes during the breedingseason and 60 % estrus induction with 30 %conception during the non-breeding season by usingNorgestomet ear implants. The better estrusinduction and fertility in Group 2 than in Group 1can be attributed to the inclusion of Crestar solution(Norgestomet and Estradiol valerate) which initiatesbetter follicular growth and behavioral estrussymptoms. The best estrus induction (100 %) withhighest (75 %) conception rate accord with thereports of Rao et al. (1985); Kathiresan (1995);Kundu (1998) and Patel et al. (2003) in buffaloes.

The better estrus response (100 %) and conceptionrate (75 %) of Group 3 in comparison to the animalsof Groups 1 and 2 might be due to the combiningeffect of implant removal with an intramuscularinjection of PMSG which stimulated the folliculardevelopment and ovulation.

Most of the buffaloes of Groups 1, 2 and 3expressed intense and intermediate estrus (50 vs.33.33, 57.10 vs. 28.60 and 37.50 vs. 37.50 %) withthe conception rate of 100 vs. 50, 75.00 vs 50 and100 vs. 66.66 % respectively. Weak symptoms ofestrus were observed in 16.67, 14.30 and 25 %buffaloes of Groups 1, 2 and 3 respectively. Only50 % animals each from Groups 2 and 3 with weakestrus sign became pregnant and none fromGroup 1.

The present findings are in agreement withthe findings of Chede (1990) who observed 38.70and 32.25 % buffaloes in intense and intermediateestrus, respectively by implanting norgestomet earimplant for 9 days. As observed in the present study37.50 vs. 37.50 % buffaloes exhibited intense andintermediate symptoms of estrus by injecting500 IU of PMSG on the day of implant removalsubstantiate the findings of Kathiresan et al. (1995)who also reported 28.50 and 43 % buffaloesexhibited intense and intermediate estrus,respectively by implanting Norgestomet ear implantfor 9 days and an injection of 500 IU of PMSG atthe time of implant removal. On the contrary to ourfindings Markendeya and Bharkad (2004) observedintermediate type of estrus in all the Deoni cowwithin 3.9 days of treatment with 70 % conceptionon implantation of Crestar.

Most of the animals of Groups 1, 2 and 3showed good and satisfactory arborization patterns(50 vs. 33.33, 42.86 vs. 42.86, and 50 vs. 37.50 %)with conception rates of 100 vs. 50, 100 vs. 66.67and 75 vs. 100 %, respectively. None of the animalmissing arborization patterns conceived. As observedin the present study, other workers also observedthat the conception rate was highest with good tosatisfactory arborization pattern and nil when it wasmissing (Kumar, 1989; Chhatry, 1998 and Nzar,2004). Our findings are in accord with the reportsof Sahasrabudhe (1995), who also reported 92.31and 75 % conception rates with good and satisfactoryarborization patterns, respectively. Similarly, Rathore(2004) also reported 80 and 71.43 % conception with


53

the best and average arborization patterns inbuffaloes. They further reported that when thearborization pattern was missing, none of the animalconceived after artificial insemination or even naturalservice.

Table 1. Distribution of animals and treatment regimens.

PID = Post Implant Day1. Crestar implant (3 mg of 17 α acetoxy, 11 β methyl, 19-norpreg-4-en-2, 20 dione) Intervet InternationalB.V. Boxmeer, Holland.2. Crestar solution (3 mg Norgestomet and 5 mg Oestradiol valerate) Intervet International B.V. Boxmeer,Holland.3. PMSG (1000 IU serum gonadotrophins) Intervet International, Holland.

Table 2. Efficacy of Crestar alone and in combination with PMSG for estrus induction and fertility.

Table 3. Estrus intensity in relation to fertility with Crestar alone and in combination with PMSG.

CR- Conception rate.

It was concluded that better conceptionrates can be obtained when animals are bred duringintense (standing) estrus with good to satisfactoryarborization patterns of cervico-vaginal mucus. Aninjection of 500 IU PMSG on the day of implantremoval has a positive effect on estrus inductionand fertility.

Group 0th Day 7th PID 9th PID 1 Crestar ear implant alone - Implant removed

2 Crestar ear implant + 2 ml Crestar solution I/M Implant removed -

3 Crestar ear implant + 2 ml Crestar solution I/M

Implant removed and Inj. 500 IU PMSG I/M -

4 Control - -

Group No. of Animals

No. of Animals responded to

treatment (%)

Duration of Induced estrus (days)

(MEAN ±± SE)

No. of Animals conceived (%)

1 8 6 (75.00) 2.500 ± 0.732 4 (66.67) 2 8 7 (87.50) 2.625 ± 0.460 5 (71.42) 3 8 8 (100.00) 2.750 ± 0.249 6 (75.00)

Group

AnimalsShowed

Intense estrus (%)

CR(%)

Animals showed Intermediate

estrus (%) CR (%)

Animals showed Weak estrus

(%)CR (%)

1 3/6 (50.0) 3/3(100.0) 2/6 (33.3) 1/2

(50.0) 1/6 (16.67) 0/1(0.0)

2 4/7 (57.1) 3/4(75.0) 2/7 (28.5) 1/2

(50.0) 1/7 (14.2) 1/1(100.0)

3 3/8 (37.5) 3/3(100.0) 3/8 (37.5) 2/3

(66.67) 2/8 (25.0) 1/2(50.0)


54

REFERENCES

Agrawal, S.K., U. Shankar, U. Kumar and G.Mohan. 1999. Studies on induction ofovarian cyclicity and progesterone profilein anoestrus cattle using a systemicprogesterone regimen-Crestar. XVth ISSARConvention Com-pendium, 21-22.

Chede, S.A. 1990. Pattern of estrus, estrusbehavior and synchronization in buffaloes.Ph. D. Thesis, Punjabrao Krishi Vidyapeeth,Akola.

Chhatry, U. 1998. Efficacy of synchronization ofestrus in true anestrus buffalo duringbreeding and low breeding season usingnorgestomet implant. M.V. Sc. Thesis,JNKVV, Jabalpur.

Hafez, E.S.E. 2000. Reproduction in FarmAnimals, 7th ed. Lippincott Williams andWilking Co., Philadelphia.

Kathiresan, D., D. Ezekial Napolean, J. Antonie, L.Dowson and S.R. Pattabiraman. 1995.Influence of ovarian status and lactationalstress on the effect of norgestomet, treatmentof buffaloes. The Blue Cross Book, 4: 25.

Kumar, S. 1989. Conception rate in relation to estruscervical mucus crystallization fern pattern inbuffaloes. Livestock Advisor., 14(12): 25-27.

Kundu, A.S. 1998. Management of summeranestrus in postpartum buffaloes withnorgestomet-estradiol-eCG combinationclinical and endocrine studies. M.V. Sc.Thesis, CCS Hariyana Agri. Uni. Hissar.

Markandeya, N.M. and G.P. Bharkad. 2004.Controlled breeding with norgestomet earimplant for induction of postpartum estrus in

Deoni Cows. Indian J. Anim. Reprod., 25(1):53-54.

Nzar 2004. Studies on induction of estrus in subestrus crossbred cows using Sodium Di-hydrogen phosphate and PGF2 alpha. M.V.Sc. Thesis, JNKVV, Jabalpur.

Patel, D.M., N.P. Sarvaiya, A.V. Patel and A.P.Parmar. 2003. Induction of estrus andhormonal profile in buffalo treated withnorgestromet ear implant. Indian J. Anim.Reprod., 24(1): 67-68

Rao, A.R. and V.S. Rao. 1984. Improved conceptionrate in buffaloes after administration ofreceptal. Indian Vet. J., 61: 813.

Rao, A.V.N., O. Srimanarayana and K.P. Rao. 1985.Estrus response and fertility in post partumanoestrus buffaloes treated with progesterone,pregnant mare serum gonadatrophin andprostaglandin during the low breeding season.Anim. Reprod. Sci., 8: 129-135.

Rathore, K.K. 2004. Studies on treatment ofanestrus in Murrah buffaloes. M.V. Sc.Thesis, JNKVV, Jabalpur.

Sahasrabudhe, S.A. 1995. Fertility respone in subestrus buffaloes treated with prostaglandinF2 alpha through different routes duringsummer. M.V. Sc Thesis, JNKVV, Jabalpur.

Singh, A., M.S. Saxena and S. Prasad. 2004.Efficacy of Crestar and its combination withfolligon on postpartum anestrus buffaloes.IJAR., 25(1): 43-49.

Tanwar, P.S., N.K. Rakha and J.B. Phogat. 2003.Challenges in buffalo infertility. Intas Polivet.,4(11): 121-127.

Table 4. Quality of arborization pattern of Cervico-Vaginal Mucus in relation to fertility at induced estrus.

Group1 Group2 Group3 Quality of arborization

pattern Buffalo (%) CR (%) Buffalo (%) CR (%) Buffalo (%) CR (%)

Good 50.00 100.00 42.86 100.00 50.00 75.00 Satisfactory 33.33 38.10 42.86 66.67 37.50 100.00 Missing 16.67 0.0 14.28 0.00 12.50 0.00


55

RE-UTILIZATION OF CRESTAR IMPLANTS FOR INDUCTION OF FERTILE ESTRUS INTRUE ANESTRUS BUFFALOES

Vivek Nayak , R.G. Agrawal, O.P. Srivastav and I.J. Sharma

Department of Animal Reproduction, Gynaecology and Obstetrics, College of Veterinary Science & A.H.,J.N.K.V.V., Jabalpur, India

ABSTRACT

The efficacy and economy of re-utilizationof Crestar implant alone and in combination withPMSG for induction of fertile estrus in 24 trueanoestrus buffaloes was investigated. The animalswere randomly divided equally in three groups. Theanimals of Groups 1 and 2 were injected with500 mg progesterone intramuscularly followed byimplantation of used Crestar (already implanted inthe other animals for 7 days) on day 4 and removedon day 9 of treatment and Group 2 was injectedwith 500 IU PMSG on the day of implant removal.Group 3 served as untreated control. On removal ofthe implant, 62.50 % buffaloes each from Groups 1and 2 expressed estrus within the mean distributionof 2.50 + 0.80 and 2.37 + 0.73 days, respectively.Sixty percent animals each from Groups 1 and 2conceived. No extra beneficial effect of PMSG wasobserved either on estrus response or conceptionrate. None of the animals from Group 3 (control)showed estrus. Only 20 and 40 percent animals ofGroup 1 and 40 and 20 percent of Group 2 expressedintense and intermediate estrus, with 100 percentconception. From these groups, 40 percent of theanimals expressed weak symptoms of estrus andfailed to conceive. Sixty percent of the animals fromboth the groups had satisfactory arborization patternswith 66.67 percent conception. However, only 20percent of the animals in both the groups showedgood arborization patterns of cervico- vaginal mucuswith 100 percent conception. None of the animalsconceived expressing weak symptoms of estrus andmissing arborization pattern. It was concluded thatutilized Crestar implant (for 7 days) can also be re-utilized to reduce the cost of treatment for inductionof fertile estrus even with out PMSG.

Keywords: crestar re-utilization, estrus induction,fertility, arborization, buffalo

INTRODUCTION

Anoestrus due to ovarian inactivity is themost important, frustrating, and challenging problemassociated with buffalo reproduction. Higherincidences of anestrus due to inactive ovaries inbuffalo than in cow have been reported by Tanwaret al. (2003). In non-cycling true anoestrus animals,the primary effect of Norgestomet is enhanced bycombining the effect of the implant removal and aninjection of small dose of PMSG to stimulate folliculardevelopment. Several reports are available regardingestrus induction using different combinations ofhormones and norgestomet ear implant. Crestar isa white silicon polymer containing 3 mg norgestometand 5 mg estradiol valerate. Kundu (1998) utilized1 1/2 and 2 implants for induction of estrus. However,no report is available on reutilization of Crestarimplants for estrus induction. Keeping this in view,the effort was made to induce fertile estrus in trueanoestrus buffaloes by re-utilization of Crestarimplants alone and in combination with PMSG.


The experimental study was undertaken in24 anestrus buffalo, aged 9 years, maintained underiso-managerial conditions. True anoestrus wasdiagnosed in the animals on the basis of anamnesistwice in gynaeco-clinically examinations at 10 daysintervals finding smooth inactive ovaries, flaccid


56

uterine horns, and non-relaxed (closed) cervix. Theanimals were randomly distributed into three groupsof eight animals and were subjected to the treatmentregimens given in Table 1.

The estrus was detected by parading abreeding bull followed by observing behavioralsymptoms and confirmed by rectal examination ofgenitalia. Buffalo exhibited in estrus were allowedfor natural service. The estrus intensity was recordedafter on spot observation as intense (standing),intermediate and weak. The arborization patternwas seen under low power (10x) and classified asgood, satisfactory and unsatisfactory (missing) afterHafez (2000). All the buffaloes of the treatmentgroups were examined gynaeco-clinically on the 12th

day post service for presence of the corpus luteum.Pregnancy was confirmed per-rectally 50 days afterbreeding. The fertility response of different treatmentregimen was evaluated in relation to intensity ofestrus and arborization pattern. An application foran ear implant was also developed (costing approx.Rs.35) which is equally effective as that suppliedby Intervet, International B.V. Boxmeer, Holland(costing approx. Rs. 2500).

RESULTS AND DISCUSSION

The results of re-utilized Crestar implantalone and in combination with PMSG for inductionof estrus and fertility in relation to estrus intensityand arborization pattern are presented in Tables 2, 3and 4. On removal of implant, 62.50 % buffaloeseach from Group 1 and 2 expressed estrus with inthe mean distribution of 2.50 + 0.80 and 2.37 + 0.73days, respectively. Sixty percent of the animals eachfrom Groups 1 and 2 conceived. No extra beneficialeffect of PMSG was observed either on estrusresponse or conception rate. None of the animalfrom Group 3 (control) showed estrus. The presentobservations support the findings of Macmillan etal. (1989), who also reported that the occurrenceof estrus was more frequent when the device wasinserted only for four days irrespective of PMSGtreatment. However, Rao (1984) observed betterestrus response (96.67 percent) by injecting 25 mgprogesterone daily for 7 days followed by 1000 IU

of PMSG on the last day of progesterone treatmentin buffaloes. Whereas, Kumar et al. (2000) inducedpronounced estrus only in 25 % of crossbred cowswithin 2.5 ± 0.5 days with 100 % conception byinjecting 50 mg of progesterone daily for 5 daysfollowed by an intramuscular injection of Estradiolvalerate 5 mg on the 7th day of treatment.

Only 20 and 40 % animals of Group 1 and40 and 20 % of Group 2 expressed intense andintermediate estrus, respectively, with 100 %conception. From the above groups, 40 % of theanimals expressed weak symptoms and failed toconceive. The poor response for intense andintermediate estrus of the animals of both the groupcan be attributed to the intramuscular injection ofprogesterone, which causes its slow decline becauserapid decline of progesterone and increase in theestrogen level is required for the manifestation ofbehavioral symptoms of estrus (Hafez,1993). Higherpercentages of weak symptoms of estrus in theanimals of both the group in the present study alsosupports the above views. However, the fact that alarger proportion (40 %) of animals of Group 2expressed intense estrus (40 %) in comparison toanimals of Group 1 (20 %) can be attributed to theeffect of PMSG.

Sixty percent of the animals from both groupshad satisfactory arborization patterns with 66.67percent conception. However, only 20 % of theanimals from both groups showed good arborizationpattern of cervico-vaginal mucus with 100 %conception. None of the animals expressing weaksymptoms of estrus and missing arborization patternconceived. As observed in the present study, variousother workers also observed that the conception ratewas highest with good to satisfactory arborizationpattern and nil when it was missing (Kumar, 1989;Chhatry, 1998 and Nzar, 2004).

Our findings are supported by the reports ofSahasrabudhe (1995), who also reported 92.31 and75 % conception rate with good and satisfactoryarborization patterns, respectively. Similarly, Rathore(2004) also reported 80 and 71.43 % conception withthe best and average the arborization pattern inbuffaloes. They further reported that when thearborization pattern was missing, none of the animalsconceived after artificial insemination or even naturalservice.


57

Table 1. Experimental plan and Treatment schedule.

Table 2. Post treatment response of anoestrus buffaloes.

An applicator for ear implant was alsodeveloped (costing approx. Rs. 35) which is equallyeffective as that supplied by Intervet, InternationalB.V. Boxmeer, Holland (costing approx Rs.2500).

Table 4. Group wise conception rate according to the quality of arborization pattern of cervico-vaginal mucus.

Table 3. Post treatment response of estrus intensity in relation to fertility.

It was concluded that utilized Crestar implants (for7 days) can also be re-utilized to reduce the cost oftreatment for induction of fertile estrus even withoutPMSG in true anoestrus buffaloes.

Group Animalsused 0th Day 4th Day 9th Day

1 8 Progesterone 500mg I/M Utilized Crestar implanted Implant removed

2 8 Progesterone 500mg I/M Utilized Crestar implanted

Implant removed and PMSG 500 IU I/M

3 8 Controls - -

Group No. of Animals

No. of Animals respond to

treatment (%)

Mean induction of estrus in days (MEAN ±± SE)

No. of Animals conceived (%)

1 8 5 (62.50) 2.50 ± 0.80 3(60.00) 2 8 5 (62.50) 2.37 ± 0.73 3(60.00)

Group Intense(%) CR (%) Intermediate (%) CR (%) Weak

(%) CR (%)

1 1(20.0)

1(100.0)

2(40.0)

2(100.0)

2(40.0)

0(0.0)

2 2(40.0)

2(100.0)

1(20.0)

1(100.0)

2(40.0)

0(0.0)

Group 1 Group 2 Quality of Arborization

PatternBuffalo (%) CR (%) Buffalo (%) CR (%)

Good 20.00 100.00 20.00 100.00 Satisfactory 60.00 66.67 60.00 66.67 Missing 20.00 0.00 20.00 0.00


58

REFERENCES

Chhatry, U. 1998. Efficacy of synchronization ofestrus in true anoestrus buffalo duringbreeding and low breeding season usingnorgestomet implant. M.V. Sc. Thesis,JNKVV, Jabalpur.

Hafez, E.S.E. 1993. Reproduction in FarmAnimals, 6th ed. Lea and Febiger, Philadelphia.

Hafez, E.S.E. 2000. Reproduction in FarmAnimals, 7th ed. Publ., Lippincott Williams andWilking Co., Philadelphia.

Kumar, N., S. Mahmood, L.P. Singh and L.N.Purbey. 2000. Induction of estrus and ovulationin post partum anesturs crossbred cows withshort term treatment. Indian J. Anim.Reprod., 21: 53-54.

Kumar, S. 1989. Conception rate in relation to estruscervical mucus crystallization fern pattern inbuffaloes. Livestock Advisor., 14(12): 25-27.

Kundu, A.S. 1998. Management of summeranestrus in postpartum buffaloes withnorgestomet-estradiol-eCG combination

clincial and endocrine studies. M.V. Sc.Thesis, CCS Hariyana Agri. Uni. Hissar.

Macmillan, K.L., A.M. Day and V.K. Toufa. 1989.Problem of non cycling cows. Proc. PrakuraFarmers. Conf., 41: 15-18.

Nzar. 2004. Studies on induction of estrus insuboestrus crossbred cows using sodium di-hydrogen phosphate and PGF2 alpha. M.V.Sc. Thesis, JNKVV, Jabalpur.

Rao, S.K. 1984. A study on treatment of anoestrusin buffaloes with certain hormones. M.V.Sc. Thesis, Andhra Pradesh AgricultureUniversity, Tirupati.

Rathore, K.K. 2004. Studies on treatment ofanoestrus in Murrah Buffaloes. M.V. Sc.Thesis, JNKVV, Jabalpur.

Sahasrabudhe, S.A. 1995. Fertility respone insuboestrus buffaloes treated withprostaglandin F2 alpha through differentroutes during summer. M.V. Sc. Thesis,JNKVV, Jabalpur.

Tanwar, P.S., N.K. Rakha and J.B. Phogat. 2003.Challenges in buffalo infertility. Intas Polivet.,4(11): 121-127.


DYSTOCIA DUE TO FETAL MALDISPOSITION IN A BUFFALO

G.K. Das, Ravi Dutt, Ravinder Kumar, S. Deori and Uma Shanker

Animal Reproduction Division, Indian Veterinary Research Institute, Izatnagar, Bareilly-243122, India

ABSTRACT

This communication reports a case ofdystocia in a pluriparous buffalo due to fetalmaldisposition. The maldisposition was caused bysevere left lateral deviation of head and neck of thefetus. It was successfully handled without any postoperative complications.

Keywords: fetal maldisposition, dystocia, buffalo

INTRODUCTION

Deviations of the head and neck arecommon type of abnormal posture in anteriorpresentation causing dystocia in all species (Roberts,1971). The deviation may be in any direction. Lateraldeviation of the head is seen most often in uniparaand the prognosis is serious when the fetus is deadand the deviations are due to muscle contractures(Sane et al., 1994). In a study, Srinivas et al. (2007)reported that 40.84 percent of dystocia in gradedMurrah buffalo is due to fetal cause, among whichhead deviations were of 42.22 percent. Presentcommunication reports a case of dystocia in a buffalodue to severe lateral deviation of the head and neckand its successful management.

HISTORY AND OBSERVATIONS

A pluriparous buffalo was presented in theVeterinary Polyclinic of the institute with a historyof labour pain for about the previous 17 h. It wasreported that the animal had completed the normalgestation period and was attended by a local

veterinarian. The buffalo had calved twice earlierwithout any complications. On general examination,the animal appeared alert and active with normalrectal temperature, pulse and respiration. The forelimbs of the calf were presented in the birth canaland the hooves were slightly protruding from thevulva. Per-vaginal examination revealed a fetus waspresented in normal anterior presentation with dorso-sacral position and a convex mass which appearedto be bent neck was presented in the pelvic inlet.The head was totally unapproachable per-vaginum.A slight repulsion revealed a severely deviated headand neck in the left lateral side. The fetus wasdiagnosed to be dead. The case was diagnosed asfetal dystocia due to severe left lateral deviation ofhead and neck on the basis of the per vaginalexamination.


Under epidural anesthesia using 2 percentlignocaine hydrochloride, both the forelimbs wererepelled back into the uterus. After properlylubricating the birth canal with obstetrical gel, themuzzle of the calf was firmly grasped and broughtround through an arc until the nose came in line withthe birth canal. Then both the forelimbs wereextended towards the vulva. With traction on thefetal head and the limbs simultaneously in a ventraldirection, a dead male fetus was delivered (Figure).Following delivery the animal was treated withenrofloxacin inj (15 ml IM x 5 days), normal saline(2 liters, IV), calcium borogluconate (450 ml, IV),and meloxicam inj (15 ml, IM) and uterotone (a herbaluterotonic) was prescribed (150 ml for 3 days orally).The animal was discharged from the polyclinic onehour after the treatment.

59


REFERENCES

Roberts, S.J. 1971. Veterinary Obstetrics andGenital Diseases. 2nd ed. CBS Publishers andDistributors.

Sane, C.R., B.R. Despande, A.S. Kaikini,D.P.Velhankar, S.B. Kodagali, S.N. Luktuke,V.B. Hukeri and V.L. Deopurkar. 1994. In: A

Textbook of Reproduction in Farm Animals.2nd ed. Varghese Publishing House

Srinivas, M., M. Sreenu, N, Laskshmi Rani, K.Subramanyam Naidu, and V. Devi Prasad.2007. Studies on dystocia in graded Murrahbuffaloes: a retrospective study. BuffaloBulletin, 26(2): 40-45.

Figure. Dead fetus delivered after correction of dystocia.

60


EFFECT OF PIROXICAM ON THE CELLULAR RESPONSEIN BUFFALO CALF SKIN

Neelu Gupta1, A.K. Katiyar2 and Madhu Swamy2

1Department of Veterinary Public Health, College of Veterinary Science & A.H. Anjora, Durg, (Chhattisgarh)India, E-mail: [email protected] of Pathology, College of Veterinary Science and A.H. JABALPUR (M.P.) India

ABSTRACT

The present work was conducted inapparently healthy buffalo calves 3-6 months in age.Calves were pretreated with piroxicamintramuscularly 30 minutes prior to intradermalinjection of Steph. epidermidis suspension andturpentine. Lesions of different time intervals wereobtained for the sequential study of cellularresponses. Maximal suppression of leukocytesoccurred at 3 h in both types of inflammation. In allthe cases, neutrophils were more extensivelysuppressed as compared to other cells.

Keywords: Staphylococcus epidermidis,turpentine, piroxicam, neutrophils, monocytes,lymphocytes, basophils

INTRODUCTION

Specific antagonistic drugs have been usedearlier in buffalo calves (Gupta et.al., 2007, 2008a,2008b) to study the chemical mediation of acuteinflammation in this species. Piroxicam is a cyclo-oxygenase inhibitor and specifically blocks thesynthesis of prostaglandins. However, to ourknowledge, no such studies have been conducted inbuffaloes. Thus, in the present study, the possiblesuppression of the cellular response in theinflammation induced by turpentine and Staph.epidermidis was studied in the buffalo calvespretreated with piroxicam.


Twelve healthy male buffalo calves, aged 3to 6 months, were divided into two groups: controland experimental, for the study of cellular responsein the buffalo calf skin. The calves were maintainedunder hygienic conditions and fed standard feed.

Substances-Normal saline: (WockhardtLtd. Aurangabad ) 0.9 % w/v, sterile pyrogen free,isotonic solution was used for the preparation of thebacterial suspension.

Staphylococcus epidermidis: (MTCC-35)the culture was obtained from the Institute ofMicrobial Technology, Chandigarh. A bacterialsuspension was prepared, and 0.1 ml was injectedintradermaley at each site. The concentration of thebacteria per ml of the suspension was determinesas 2.3 x 103 million.

Turpentine- (SAM KAM, INDORE) thecommercially available turpentine was usedintradermally for the induction of inflammation. Ateach site 0.05 ml turpentine was injected.

Piroxicam- (Pfizer Limited Batch No.020-04065 Mumbai) of 20 mg /ml strength was used asa prostaglandin antagonist.

Preparation of skin- The site of thecutaneous reaction was prepared according to themethod described in horses (Zarrilli and Calhoun,1970) with suitable modifications. Briefly, one daybefore induction of the inflammation, hair from thelateral thoraco-abdominal region of the buffalocalves was removed by close shaving. The skin wascleaned with a soft cloth moistened with the steriledistilled water. On the following day, cleaning of theskin was repeated.

61


Induction of inflammation- Inflammationwas induced in the buffalo calf skin as described inthe following groups.

Control Group I- Six calves of the controlgroup were again divided into two subgroups, i.e.,Subgroup I A and Subgroup I B. Each subgroup hadthree calves.

Subgroup IA- Each calf received twointradermal injections of the Steph. epidermidis(MTCC-35) suspension (0.1 ml) in the normal saline(Wockhardt Ltd. Aurangabad) for each time interval(0-2 minutes, 30 minutes, 1 h, 3 h, 6 h, 12 h, 24 h and48 h) at both sides of the thoraco-abdominal region.At the appropriate time (immediately after the 0-2time interval. The calves were euthanized with asaturated solution of magnesium sulphate givenintravenously. The skin specimens were collectedand fixed in the Cornoy’s fluid for the histo-pathological studies as described for the chicken byShrivastava et al., 1997. Sections were cut to 4-5μm thickness.

Skin sections were stained with thehaematoxylin and eosin and with 0.05 percentsolution of the toluidine blue in acetate buffer (pH3.8) for basophils as described for the chickens byDhodapkar et al. (1987).

Subgroup IB- Each calf received two i/dinjection of the turpentine (SAM KAM, INDORE)@ dose rate of 0.05ml for each time interval (0-2minutes, 30 minutes, 1 h, 3 h, 6 h, 12 h, 24 h and48 h). The rest of the procedure was the same asthat for Subgroup IA.

Experimental Group II- Six calves of theexperimental group were again divided into twosubgroups i.e., Subgroup II A and Subgroup II B.Each subgroup had three calves.

Subgroup II A- Each calf was pretreatedwith piroxicam (Pfizer Limited Batch No. 020-04065, Mumbai) i/m, at the dose rate of 0.3 mg/kgbody weight 30 minutes prior to the i/d Steph.epidermidis and this treatment was repeated every12 h. The rest of the procedure was the same asthat for control group IA.

Subgroup II B- Each calf was pretreatedwith piroxicam i/m, at the dose rate of 0.3 mg/kgbody weight 30 minutes prior to i/d injection of theturpentine (0.05 ml), and this treatment was repeatedevery 12 h. The rest of the procedure was the sameas that for control group IA.

RESULT AND DISCUSSION

Control Group ISubgroup IA- The inflammatory reaction

in the calf was induced by giving intradermalinjections of Steph. epidermidis, and lesions of 0-2minutes, 30 minutes, 1 h, 3 h, 6 h, 12 h, 24 h and 48h were collected for the histopathology. The vascularand cellular changes were not noticeable at the initialintervals (0-2 minutes and 30 minutes). However, afew neutrophils were found at 0-2minutes and 30minutes. At 6 h, hyperaemia of the blood vesselsand oedema of the dermis were well marked. From30 minutes onwards, leukocytes infiltration hadsignificantly increased, and the maximal number ofleukocytes were observed at 12 h. The maximumnumbers of neutrophils, monocytes, lymphocytes andbasophils were recorded at 6, 12, 24 and 1 h,respectively. Infiltration of eosionophils was notnoticed at any time interval (Table 1)

Subgroup IB- The inflammatory reactionin the calf was induced by giving intradermalinoculations of turpentine (0.5 ml), and lesions ofdifferent time intervals were collected forhistopathology. The vascular and cellular changeswere noticed from 30 minutes onward to 48 h. Afew leukocytes were seen adhering to endothelium.From 30 minutes onwards cellular infiltration hadsignificantly increased, and the maximal number ofleukocytes was observed at 12 h. The number ofneutrophils increased gradually up to 6 h, after whichthe number gradually decreased, but there weremore than in the initial stages. The maximal numberof neutrophils was observed at 6 h. The number ofmonocytes increased gradually up to 12 h, afterwhich it decreased. Marked infiltration of monocyteswere observed at 12 h. From 1 h onwards infiltrationof lymphocytes increased, and the maximal numberof lymphocytes was recorded at 48 h. Toluidine bluesections showed infiltration of basophils. Infiltrationof basophils were observed from 30 minutes andgradually increased up to 3 h. Infiltration ofeosionophils was not noticed at any time interval(Table 2).Experimental group II-

Subgroup II A- Calves were pretreatedwith Piroxicam intramuscularly 30 minutes prior tointradermal injection of the Steph. epidermidissuspension, and lesions of different ages were

62


Figure 1.

Figure 2.

Figure 3.

Figure 4.

Figure 5.

Figure 6.

Figure 7.

Figure 8.

Figure 9.

Figure 1. Section of buffalo calf skin 30 minutes after intradermal injection of Staph. epidermidis suspension. Note - emigration of leukocytes. H &E x 400.Figure 2. Section of buffalo calf skin 30 minutes after intradermal injection of turpentine. Note - emigration of leukocytes. H &E x 400.Figure 3. Section of buffalo calf skin 12 h after intradermal injection of Staph. epidermidis suspension. Note- intense infiltration of leukocytes. H&E x 400.Figure 4. Section of buffalo calf skin 12 h after intradermal injection of turpentine. Note- maximal number of leukocytes. H&E x 400.Figure 5. Section of piroxicam preatreated buffalo calf skin 3 h after intradermal injection of Satph. epidermidis suspension. Note-maximal suppression of leukocytes. H&E x 400.Figure 6. Section of piroxicam preatreated buffalo calf skin 3 h after intradermal injection of turpentine. Note-maximal suppression of leukocytes. H&E x 400.Figure 7. Section of buffalo calf skin 48 h after intradermal injection turpentine. Note- completely disintegrated neutrophils. H&E x 400.Figure 8. Section of buffalo calf skin 12 h after intradermal injection turpentine. Note- the presence of giant cells in the interstitium. H&E x 400.Figure 9. Section of piroxicam preatreated buffalo calf skin 12 h after intradermal injection of Turpentine. Note- the presence of giant cells in the interstitium. H&E x 400.

63


ot esnopser ni sis otycokuel eussiT .1 elbaTsidi

mredi pe su cc ocol yhpat S.sev lac ola ff ub d eta er ter p

macix ori p dna lortno c ni

64

d leif c i poc sor cim ) 004 x( rewo p h giH / )E. S± sn aeM ( sety coku el f o rebmuN

my L set yc on o

M slihpo rt ue N

l atoT sl ihp o saB

se tyc oh p emiT

lavr e tnI .hpatS

sid im re dipe ma c ix ori P

t necr eP

isserp puS

no

. h patS

- redi p e

sidim

maci xoriP tnecr eP

n o iss e r pp uS

.h p at S

-redip e

si di m

m ac ixori P

tn ecre P

ser p puS

n o is

. hp at S

-r edip e

si dim

ma ci x ori P

tn ec re P

i ss e rppu S

no

.h p at S

-re d ipe

si di m

ma c ix or i P

tne cr eP

i sse r ppu S

no

nim 2-0

nim 0 3

rh 1

rh 3

rh 6

rh 21

r h 42

r h 84

00

334.0

1 22.0±

006 .01 299.0 ±

661 .03 6 99. 1±

664.95 676. 4±

662. 05 602 .1±

660. 01 320.3±

00

00

334 .0

521.0±

0 0. 9 946. 0±

009.02 866 .1±

0 0.25 291.3±

661 .54 4 61 .3±

0 0 3.9 036 . 0±

0 0

00 00

90. 51

730 .33

555 ,21

641 .0 1

0 9 6. 7

0 0

00 00

335.1 465 .0±

33 0.3 4 87 .0±

66 7. 5 1 97 5.1±

66 3.7 2 388 .1±

660 .5 035.1±

0 0

0 0 00

66 4.1 72 2. 0±

00 6.2 13 0. 1±

667 .01 3 45.1 ±

667 .52 487 .1±

3 39 .4 3 25.0 ±

0 0

00 00

07 3. 4

6 72 . 41

0 66 . 61

64 8.5

905 .2

00

00 00

0 01. 1 471 .0 ±

3 39.1 455. 0 ±

0 0. 0 1 725. 0±

3 3.4 1 367.1±

66 3.8 1 747 . 1±

00

0 0 0 0

0 08. 0 361 .0 ±

663. 1 49 1. 0±

0 02. 8 171 .0±

334 .21 846 .1±

0 0.8 1 7 26 .0±

00

00 00

27 2 .7 2

233 .92

00.8 1

73 2.3 1

299 .1

0 0

0 0

6 61. 1

5 21 .0 ±

3 36.2 54 2 .2±

3 30 . 2 135.0 ±

6 6 5. 1 4 91 .0±

8. 0 94 1.0±

0 0 00

0 0

00. 1

94 1.0 ±

66 1 .2 7 8 2. 0±

33 8.1 7 53 .0±

33 4.1 491 .0±

66 7.0 36 1.0±

00 00

0 0

632 .41

637 .71

738 .9

14 1.8

052 .4

00 0 0

00

6.1

872. 0±

66 9.51 8 63 . 1±

33 2.7 3 29 5.2±

669 .58 052 . 3±

3 38 .29 969.2 ±

004. 23 8 05. 3±

00

0 0

33 4.1

122 .0±

0 03. 31 30 6.0 ±

66 0.6 2 79 6.3 ±

66 0.3 7 50 9.3 ±

003.3 8 6 27.2 ±

0 06. 13 188 .0±

00

00

734 .01

986. 21

299. 9 2

205 .41

8 62. 01

96 4.2

00


.sevlac olaf fub d eta ert er p ma cixo rip d na l ortn oc ni en it nep rut ot es nopser ni siso tycokuel eussiT .2 elb aT

65

dl eif c ipocsorcim )0 04 x( re

wop h giH / )E.S ± snae

M ( set yco ku el fo rebmu

N

myL setycon o

M s li hp ortue

N latoT

slih posaB setyc ohp

em iT

-retnI

lav-epruT

eni tn

macixoriP

tnecreP

-reppus

noiss

-epruT

e n itn

maci xor iP

tnecreP

s e rppu s

n ois-

t ne pr uT

en i-

macixoriP

tn ec reP

-r eppus

noiss

-tnepruT

en i

macixoriP

tnecreP

-s erppus

n ois

-tne pru T

e ni

mac ixoriP

tnec reP

-s erp pus

nois

nim 2-0

nim 03

rh 1

rh 3

rh 6

rh 21

rh 42

rh 84

00

002 .01

602 .1± 0 05 .42 633 .1±

69. 7316

267 .6±

38 .4423

200.5±

68.69 16

23.3±

06.4310

599.2±

3 39. 49 680.4±

00

02 .9

501.0±

334.12 66 0.1±

002.89 014 .1±

664.581 457.5±

334.951 107. 1±

065.8 11 482.0±

334 .58 145.3±

00

88 0.9

81 5.2 1

328.8 2

742.42

4 10. 91

61 9. 11

70 0.0 1

0 0

334 .0 491. 0 ±

0 03 . 2 402.0 ±

0 03. 81 720.1±

035.17 738.2±

338 .59 0 89.4±

665 .27 980 .3±

336.84 664 .2±

00

004.0 941 .0

330 .2 323.0±

667.51 987.0±

00 5.65 151.3±

067.2 8 754 .2±

66 3.9 6 894 .4±

66 1. 84 383 .2 ±

00

1 26. 7

80 6.1 1

64 8.3 1

602 .52

536 .31

904.4

069.0

00 0 0

008.1 205. 0±

004.7 8 59.0±

667 .44 967.4±

664.46 484.2±

661.131 01 2.3±

662.241 308 .3±

00 00

0 05. 1 21 9.0±

33 3.5 764.0±

666 .93 097.1±

06 7.0 6 917.2±

.1±0 07. 52 1193

002.041 572.2±

00 00

06 6.6 1

239.72

293.11

847.5

973.4

254 .1

00

337 .1

063 .0±

330.3 816.0±

666.5 057.0 ±

33 1.4 063.0±

0 06.2 025.0±

664.1 27 1.0±

00

00

0 07. 1

9 22.0±

33 8.2 254 .0±

338.4 323 .0±

338.3 185.0±

339.1 102. 0±

334 .1 491.0 ±

00

00

409.1

49 5.6

107.41

852 .7

565.2

152.2

00

00

5 .21

509.0±

33 4.2 3 40 9.1±

333. 961 021.5±

660.563 74 9.6±

0 09. 853 148.6±

333.143 554.5±

338.58 2 273. 4±

00

1. 01

252.0±

33 5.72 30 9.1±

331.421 128.1±

371 .282 036.3±

332.503 580.4±

332.413 8 28.6 ±

008.372 469.3±

00

002.91

330.61

296.62

717 .22

3 59 .41

939.7

902.4


obtained and processed for histopathlogicalexamination. The vascular and cellular changes werenoticed from 30 minutes onward to 48 h. Themaximal number of leukocytes was observed at 12h, but there were fewer than in the control group.However, maximal suppression of leukocytes wasobserved at 3 h. Infiltration of neutrophils was moremarked at 6 h. While maximal suppression ofneutrophils was recorded at 3 h. The maximalnumber of the monocytes was recorded at 12 h,while maximal suppression of monocytes at 6 h.Marked infiltration of lymphocytes was observed at24 h. However, maximal suppression of lymphocyteswas seen at 3 h. Maximal basophil suppression wasobserved at 1 h. Infiltration of eosionophils was notnoticed at any time interval (Table 1).

Subgropup II B- Thirty minutes beforeintradermal injection of turpentine, the calves werepretreated with the piroxicam intramuscularly, andthe lesions as per the non-pretreated group wereobtained and processed for histopathologicalexamination. The vascular and cellular changes werenoticed from 30 minutes onward to 48 h. Themaximal number of leukocytes were observed at24 h. However, maximal suppression of leukocyteswas observed at 3 h. Neutrophils were more markedat 6 h. While maximal suppression of neutrophilswas recorded at 3 h. Monocytes were noted from30 minutes onwards up to 24 h. The maximal numberof monocytes was recorded at 48 h while maximalsuppression of monocytes was at 6 h. Multinucleatedgiant cells were observed at 12 and 24 h.Lymphocytes were noted at 1 h to 48 h. Markedinfiltration of lymphocytes was observed at 48 h.However, maximal suppression of lymphocytes wasseen at 3 h. Few basophils were noted at 30 minutesonward to 24 h. The maximal number of thebasophils was observed at 3 h, and suppression ofthe basophils was noted at 3 h. Infiltration ofeosionophils was not noticed at any time interval(Table 2). Pretreatment with the prostaglandinantagonist piroxicam caused suppression of the totalleukocyte infiltration in both turpentine and Staph.Epidermidis-induced buffalo inflammation. At 3 h,maximal suppression of leukocytes occurred in bothtypes of injury. However, in the turpentine inducedreaction, piroxicam caused maximal suppression ofthe neutrophils, lymphocytes and basophils at 3 h,

and of monocytes at 6 h. Whereas, in the Staph.Epidermidis-injury it resulted in maximalsuppression of neutrophils and lymphocytes at 3 h,monocytes at 6 h, and basophils at 1 h. Issekutz andMovat (1982) studied the effect of prostaglandin onpolymorphonuclear leukocyte infiltration. Theyconcluded that prostaglandins enhance chemotactic-factor-mediated poly-morphonuclear infiltration.Since, piroxicam is a cyclooxygenase pathwayinhibitor through which the prostaglandins areformed, pretreatment with the drug may also causesuppression of neutrophil infiltration. Gupta et al.(2008) reported that intradermal injection of S.epidermidids suspension and turpentine resulted inan inflammatory reaction in buffalo calf skin. Theinflammation-induced vascular permeability wassignificantly suppressed by injection of theprostaglandin antagonist drug piroxicam, indicatingthat the prostaglandins might be responsible forincreased vascular permeability in inflammation. Inthe present study, the greater suppression ofneutrophils indirectly indicates the suppression ofprostaglandin synthesis due to piroxicampretreatment. Taken together our results indicate thatthe prostaglandins may play a role in the mediationin the cellular response in buffalo inflammation.

REFERENCES

Dhodapkar, B.S., J.L. Vegad, R.G. Dhawedkar andG.N. Kolte. 1984. Pathology of reversedpassive arthus reaction in the chicken. AvianPathol., 13: 93-108.

Gupta, N., A.K. Katiyar and M. Swamy. 2007. Roleof histamine in turpentine induced cellularinflammatory response of buffalo calves.Indian Vet. J., 4: 363-364.

Gupta, N., A.K. Katiyar and M. Swamy. 2008a.Effect of promethazine hydrochloride on thevascular permeability and cellular response ofbuffalo calves. Indian Vet. J., 11: 1152-1154.

Gupta, N., A.K. Katiyar and M. Swamy. 2008b.Effect of piroxicam on the vascularpermeability in buffalo calf . Indian Vet. J.,11: 1354-1355.

*Continued on page 72

66


ULTRASONOGRAPHIC BIOMETRY OF THE OVARY AND ITS RESPONSES DURINGSUPEROVULATION IN TODA BUFFALOES

D.V. Patel2, R. Anil Kumar1*, M.Iyue1 and R. Kasiraj2

1Sheep Breeding Research Station, Tamilnadu Veterinary and Animal Sciences University, Sandynallah, Ooty,Nilgiris -643 237, Tamilnadu, India, *E-mail: [email protected] Ashram Gaushala, Bidaj Farm, PO- Lali, Dist, Kheda, Gujarat-387 120, India

ABSTRACT

Eight superovulated Toda buffaloes werestudied ultrasonographically to record the biometryof the ovarian structures and superovulatoryresponse during superovulation and flushingprogramme, conducted in this breed as a breedconservation measure. Ovarian size (10 buffaloes)and structural changes (eight superovulatedbuffaloes) were monitored on a) the 10th day postheat (before initiation of FSH) b) Post SOV heat(the 3rd day of superovulatory heat) and c) on theday of flushing. The animals were subjected tosuperovulation with either 400 or 600 mg FSH(Folltropin V). The superovulation was initiated fromthe 10th day of the estrous cycle, and embryos werecollected on the 5.5 to 6 day of post superovulatory(SOV) heat. Before SOV programming, the averagesize of the left ovary was found to be 24.67 + 2.35mm while the right ovary measured 26.11 + 1.71mm and the average size of CL was 14.50 + 3.28mm. There was significant increase in the lengthand width of ovaries post superovulation and on theday of flushing. A greater number of ovarianstructures (CL/follicles) were found at the time offlushing than during post SOV heat indicating late/an-ovulations (post heat). The average size of thefollicle showed increase on the day of flushing, dueto cystic ovarian condition in a few buffaloes. Lateovulation and a lower number of recruited folliclesduring superovulation may be the reason for lowerresponse in Toda buffaloes than in other breeds ofbuffaloes.

Keywords: Toda buffalo, ultrasonography,superovulation, ovary

INTRODUCTION

Buffaloes (Bubalus bubalis) in general areknown to be very poor responders to superovulationprotocols in comparison to white cattle. The totalpopulation of follicles is comparatively lower inbuffaloes than in cattle (Madan, 1990).

The main problem encountered duringsuperovulation with different hormones based onearlier reports on superovulation was the availabilityof anovulatory follicle, leading to few and poor qualityembryos (Madan et al., 1996 and Misra, 1997). Inaddition the quality of CL and presence of un-ovulated follicle is also known to influence therecruitment of new follicles.

Several reports suggest a lower follicularpopulation in the buffalo ovaries (Madan, 1990 andTotey et al., 1991). It is essential to know the numberof follicles recruited and CL available in buffaloesbefore and during superovulation and embryocollection programme. Hence an attempt has beenmade to study ovarian size and structures usingultrasound scanner in the semi wild Toda buffaloesof Nilgiris district of Tamil Nadu, duringsuperovulation. The study was carried out at theSheep Breeding Research Station, Sandynallah,Nilgiris, in collaboration with Sabarmati AshramGaushala, Bidaj Farm, Gujarat, under theconservation project funded by the Department ofBiotechnology, Government of India and the NationalDairy Development Board.

67



Ten female Toda buffaloes were purchasedfrom Toda hamlets (Toda munds) and were managedunder a semi-intensive system of management atthe Sheep Breeding Research Station, Sandynallah,The Nilgiris. During the day time, the animals wereallowed to graze on natural pastures of the farmland. The animals were fed with 2 kg of concentrateration per day per animal.

The work was undertaken during December2006. The estrum in Toda buffaloes weresynchronized with two injections of prostaglandin,(inj. Iliren- 5 ml i/m; Hoechst, India) 11 day apart.Post second PG, animals were checked per-rectallyat 72 h for the presence of follicle on ovary, uterinetone and discharge. The animals reporting for estrumwere selected for superovulation. Eight buffaloeswere superovulated using either 400 mg or 600 mgof NIH-FSH-P1 (Folltorpin-V, Vetrepharm, Ontario,Canada). FSH was given from the 10th day of theestrous cycle for 5 days in a tapering dose rate.Luteolysis was induced with prostaglandin injectionalong with a 7th and 8th FSH dose. All the animalsreporting to oestrum (48-72 h post PG) were allowedto be bred by the Toda bull. The superovulatedanimals were flushed on the 5.5 or 6th day afterbreeding. The number of corpora lutea was countedper-rectally before flushing. Flushing was carriedout as per the standard procedures (Misra et al.,1980) using 18 gauge Rusch catheter (Minitub,Germany) and DPBS media (IMV, France) with0.1 % Bovine Serum Albumin (Sigma) added.

An ultrasound scanner was used to recordthe ovarian structures and superovulatory responsein these animals during the superovulation andflushing programme. Ovarian size (10 buffaloes) andstructural changes (8 superovulated buffaloes) weremonitored on a) the 10th day post heat (beforeinitiation of FSH) b) post SOV heat (3rd day) and c)on the day of flushing.

A real time B-mode ultrasound scanner(Medison SA600V, BCF Technology Ltd., Scotland)equipped with a 5.0 MHz linear-array rectaltransducer and a video graphic printer (Sony, Japan)was used for this study. The total follicle populationwas recorded as appreciated by anechoic black

structures, while CL with granular structures andmore echogenicity were recorded and measured.For comparison, two pairs of ovaries were collectedfrom Toda buffaloes from a slaughter house. Theovarian size and structure were recorded.

The means and standard errors for allvariables were calculated and presented.Differences between the ovarian size and thenumber of follicles and corpus luteum before andafter superovulation were tested by Student “t” test.


Buffaloes are regarded to have a lowerreproductive efficiency and several reports suggestlower follicular population in the buffalo ovaries(Madan, 1990 and Totey et al., 1991). The meanlength, width and height of ovaries in slaughterspecimens were 31.00 + 5.00, 13.50 + 0.50 and14.00 + 1.00 mm (Lt. Ovary) and 27.50 + 1.50, 25.00+ 2.00 and 14.50 + 4.50 mm (Rt. Ovary), respectively(Table 1). The mean length, width and height ofovaries of Toda buffaloes were greater than thoseobserved in non-descript buffaloes by Chandrahasanand Rajasekaran (2004) and in Murrah buffaloesby Kumar et al. (2004). Both left ovaries in slaughterspecimens had mature projecting CL of 15 mm and10 mm in size. One of the right ovaries had a graffianfollicle of 15 mm in size.

Significant superovulatory changes in thelength and width of ovaries prior to and postsuperovulation were observed. The smallest normalovary was found to be 13 x10 mm (length x width),while the biggest ovary measured 37 x 29 mm. Onthe day of flushing, they measured 17 x 17 mm and42 x 36 mm, respectively. The length and width ofovary as observed with ultrasonography in this studywas higher than that found by Chandrahasan andRajsekaran (2004) in non-descript buffaloes andKumar et al. (2004) in Murrah buffaloes. Use ofFSH increased the size of ovary significantly at postSOV heat. Also significant increase (P<0.05) in thesize of the ovary on the day of flushing wasobserved. The changes in ovary size and structuresduring superovulation are shown in Figure 1.

68


Corpus luteum was present in all the animalsstudied on the day of SOV, and there was an increase(1.67 + 0.24) in the number on the day of flushing(Table 3). Similarly, there was an increase in theavailability of number of follicles in response tosuperovulation. The average size of follicle on theday of flushing (10.25 + 1.28) was greater ascompared to the 10th day (9.00 + 0.82).

On the 10th day post heat, six buffaloes wereshown to have a distinct CL, while in two buffaloes,CL was not found in any of the ovaries. However,both the buffaloes had follicles in their ovaries. Therewas an increase in number of CL on the day offlushing (1.67 + 0.24) compared to the number foundon the 10th day (1.00 + 0.00). However, there wasno difference in the number of CL on post SOVheat (1.00 + 0.00) and the 10th day. Similarly, therewas no difference in the availability of follicles onpost SOV heat (4.00 + 0.44) and on the day offlushing (3.64 + 0.61). Both these findings indicatethat the buffaloes in this study had late ovulations(post heat), and that the number of recruited follicleseven during superovulation was low.

Overall, there was no significant responsein the presence of ovarian structures on the 10th

day or post SOV heat or on flushing day. Thepresence of a lower number of primordial folliclesand poor recruitment of follicles on the 10th day ofcycle may be the reason for the lower response.The current results are in agreement with the findings

of Madan (1990), who showed that buffaloes havea low number of primordial follicles at the 10th dayof the estrous cycle. However, Chandrahasan andRajsekaran (2004) found a greater number (3.41 +0.11) of follicles than Toda buffaloes (2.80 + 0.63).Rohilla et al. (2005) also found 7.7 + 0.3 follicles inanoestrus Murrah buffaloes by ultrasonography.

The size of the follicle observed in this studywas comparable to the ultrasonographic studies byHonparkhe et al. (2003) and Rohilla et al. (2005).The average size of the follicle on the flushing day(10.25 + 1.28 mm) was greater as compared to the10th day (9.00 + 0.82 mm). This increase in size ofthe follicle may be due to the presence of cysts (16-22 mm) found on the day of flushing in threebuffaloes. The size of CL was larger than thosestudied by Honparkhe et al . (2003) andChandrahasan and Rajsekaran (2004).

In conclusion, Toda buffaloes were found tohave large-sized ovaries compared to Murrahbuffaloes, but their response to superovulation wasvery poor, which might be due to a lower number ofprimordial follicles than in other buffaloes. Morestudy with the use of different hormone regimensalong with ultrasonography are required to fullyexploit the germplasm of these buffaloes. It wasobserved that ultrasound can be a very good toolfor more detailed, reliable and accurate study ofovarian responses to superovulation in buffaloes.

69


Figure 1. Ovary and structural changes during superovulation.

70


Table 1. Ovarian biometry of two pairs of ovaries obtained from a slaughter house.

Table 2. Mean (+ SE) of superovulatory changes in ovarian size (mm).

Means in the same column within categories with different superscript differ significantly (p<0.05).

Table 3. Mean (+ SE) of number of ovarian structures and their size (mm) during superovulation.

71

Sl.No. Side Length

in mm Width in

mmHeight in mm

Corpus luteum (CL) /Follicle (F) Remarks

Left 36 14 15 1.0 1CL, 3F 1Right 29 23 19 1.0 1CL Left 26 13 13 1.0 1LF, 1SCL 2

Right 26 17 10 0.0 1SCL

Length Width Particulars Lt. Ovary Rt. Ovary Lt. Ovary Rt. Ovary

10th day (prior to SOV) 24.67 ± 2.35a 26.11 ± 1.71 18.00 ± 2.03a 19.11 ± 1.72a

Post SOV Heat 30.63 ± 1.77b 29.50 ± 2.19 23.50 ± 2.37b 23.75 ± 2.39b

Flushing day 33.71 ± 1.69b 31.00 ± 3.42 25.57 ± 2.02b 25.86 ± 2.41b

Number available Average Size (mm) Particulars

CL Follicle CL Follicle

10th day (prior to SOV) 1.00 ± 0.00 2.80 ± 0.63 14.50 ± 3.28 9.00 ± 0.82

Post SOV Heat 1.00 ± 0.00 4.00 ± 0.44 12.88 ± 2.19 9.42 ± 1.07

Flushing day 1.67 ± 0.24 3.64 ± 0.61 12.21 ± 0.79 10.25 ± 1.28


ACKNOWLEDGEMENTS

Authors are grateful to the Professor andHead, Department of Animal Reproduction,Gynaecology and Obstetrics, Veterinary College andResearch Institute, Namakkal, Tamilnadu, forproviding ultrasonography instrument for this study.We also thank Dr. K. Krishnakumar, AssociateProfessor, VCRI, Namakkal, for his help in the initialdemonstration of ultrasonography.

REFERENCES

Chandrahasan, C. and J. Rajasekaran. 2004.Biometry of buffalo (Bubalus bubalis)ovaries in relation to different stages of theoestrous cycle. Indian J. Anim. Reprod.,25(2): 87-90.

Kumar, S., F.A.Ahmed and M.S. Bhadwal. 2004.Biometry of female genitalia of Murrah buffalo(Bubalus bubalis). Indian J. Anim. Reprod.,25(2): 143-145.

Madan, M.L. 1990. Factors limiting super-ovulationresponse in embryo transfer programmeamong buffaloes. Theriogenology, 33: 280.

Madan, M.L., S.K. Das and P. Palta. 1996.Application of reproductive technology tobuffalo. Anim. Reprod. Sci., 42: 299-306.

Misra, A.K., M.C. Yadav, and K.T. Motwani. 1988.Successful embryo transfer in a buffalo(Bubalus bubalis).In Proc. of the SecondWorld Buffalo Congress, New Delhi, India,I: 56.

Honparkhe, M., V.K. Gandotra, A.S. Nanda and S.Prabhakar. 2003. A comparison of rectalpalpation and ultrasonography for the detectionof follicle(s) and corpus luteum in pluriparousbuffaloes. Indian J. Anim. Reprod., 24(2):149-151.

Rohilla, N., U. Singh, R.K. Sharma and I. Singh.2005. Ultrasonic ovarian status in summeranestrus postpartum Murrah buffaloes. IndianJ. Anim. Reprod.Indian J. Anim. Reprod.,26(2): 95-98.

Totey, S.M., G. Singh, M. Taneja and G.P. Talwar.1991. In vitro maturation and fertilization offollicular oocytes from buffalo.Theriogenology, 35: 284.

*Continued from page 66

Issekutz, A.A. and H.Z.C. Movat. 1982. The effectof vasodilator prostaglndins onpolymorphonuclear leukocyte infiltration andvascular injury. Am. J. Path., 107: 300-309.

Shrivastava, A.B., J.L. Vegad and A.K. Katiyar.1997. Inflammatory response of skinautograftin in the chicken. Ind. J. Anim. Sci.,67: 387-391.

Spector, T.S. 1989. An Introduction to GeneralPathology, 3rd ed. Churchill Livingstone,Edinburg.

Vegad J.L. 1979 . The acute inflammatory responsein the sheep skin. Vety. Bull. Weybridge., 49:555-561.

Vegad, J.L. and A.K. Katiyar. 1995. The acuteinflammatory response in the chicken. Vet.Bull., 65: 399-409.

Zarrilli, L.W. and M.L. Calhoun. 1970. Cellularresponse to equine encephalomyelitis vaccinein skin window of horses. Amer. J. Vet. Res.,31: 97-102.

72


SEROPREVALENCE OF BRUCELLA SPP. IN BUFFALOES IN THE CENTRAL GUJARATREGION OF INDIA

M.N. Brahmabhatt, R.N. Varasada, C.D. Bhong and J.B. Nayak

Department of Veterinary Public Health, College of Veterinary Science & Animal Husbandry, AnandAgricultural University, Anand Gujarat - 388 001, India

ABSTRACT

Brucellosis remains a major threat from thezoonotic as well as the economic point of view. Theprevalence of brucellosis in the central Gujarat wasstudied using the rose bengal presipitation test(RBPT), standard tube agglutination test (STAT) andindirect enzyme-linked immunosorbent assay (i-ELISA). The seroprevalence was found to be 12.75percent, 11.16 percent and 19.12 percent by RBPT,STAT and i-ELISA, respectively.

Keywords: buffalo, brucellosis, seroprevalence

INTRODUCTION

Brucellosis has long been a major threat tolivestock. It is mainly a disease of domestic animalscaused by various strains of Brucella spp. Bovinebrucellosis is found worldwide, but it has beeneradicated from many countries. The rate of infectionvaries greatly from one country to another andbetween regions within a country. The diseasecauses heavy economic losses due to abortion,premature births, decreased milk yield and repeatbreeding leading to temporary or permanent infertilityin infected livestock (Yagupsky, 1999).

The diagnosis of the disease can bechallenging and is frequently delayed or missedbecause the clinical picture may mimic otherinfectious and noninfectious conditions (Araj, 1999;Yagupsky, 1999). Diagnosis can be established bylaboratory methods such as serology and bloodcultures. Prolonged incubation periods, specialgrowth media, and subcultures are required for theisolation of these fastidious, slow growing bacteria.

However, cultures are not always positive whenother tests are positive (Romero et al., 1995).Automated systems have been reported to detectmore than 95 % of Brucella melitensis-positivecultures within seven days of incubation (Yagupsky,1999). The technology is lacking in developingcountries or rural areas where the disease isprevalent and diagnoses rely mainly on serology.Many serological tests have been used for thediagnosis of human brucellosis, such as agglutinationtests, indirect immunofluorescence, rose bengal platetest (RBPT), standard tube agglutination Test(STAT), and ELISA specially Dot-ELISA &Indirect-ELISA. The most commonly used tests arethe serum agglutination test, Coombs anti-Brucellatest, rose bengal test, and complement fixation(Orduna, 2000).

Buffalo milk and milk products are anappreciable source of income of farmers of India,that is why buffaloes are integral part of theeconomy of rural people. Hence, this study wascarried out to find out the seroprevalence ofBrucella spp. in central Gujarat, Anand, Kaira,Ahmedabad and Vadodara districts of Gujarat(India). These districts are one of the biggest pocketsof milk production in India and also the location of aworld famous dairy co-operative-AMUL.


A total of 251 (230 female and 21 male) serasamples from buffaloes were collected from variousplaces of four districts in Central Gujarat, viz., Anand(78), Kaira (60), Ahmedabad (86) and Vadodara(27). Collected sera samples were subjected to rosebengal plate test. (RBPT), standard tube

73

∼


agglutination Test (STAT) and indirect-enzyme linkedimmunosorbant assay (i-ELISA). The RBPT antigenand Brucella abortus agglutinating antigen for STATwas procured from the Division of BiologicalProducts, Indian Veterinary Research Institute(I.V.R.I.); Izatnagar, Uttar Pradesh (India). The testswere conducted as per manufacturer’s instructions.For i-ELISA, smooth lipopolysaccharide (S-LPS)based (A-B-ELISA) kits supplied by the All IndiaCoordinated Research Project (AICRP) on AnimalDisease Monitoring and Surveillance (ADMAS),Bangalore, was used. The test was performed asper the manufacture’s instructions.

i-ELISA was compared with RBPT andSTAT, considering i-ELISA as the gold standard testas per Hobbs (1985) and Nielsen et al. (1996), todetermine the relative sensitivity and specificity ofRBPT and STAT.


Out of 251 sera tested during present studywith RBPT, 32 (12.75 %) were found positive. WithSTAT, 28 (11.16 %) gave positive while 48(19.12 %) reacted as positive when tested with i-ELISA. The highest (23.26 %) prevalence was foundin Ahemdabad district, while prevalences were20.51 %, 7.40 % and 16.67 % in Anand, Vadodaraand Kaira districts, respectively (Table 1).

Out of 230 females and 21 males tested, 43(18.70 %), 29 (12.61 %) and 25 (10.87 %) were

found positive by the i-ELISA, RBPT, and STATtests, respectively, in females while 5 (23.81 %), 3(14.29 %), and 3 (14.29 %) were found positive inbulls by the respective tests.

The prevalence of brucellosis was 19.12 %.These findings were comparable to the results ofSharma and Saini (1995), who found 14.61 %prevalence in Punjab, India. This finding alsosupported Chatterjee et al. (1984) who found 19.6percent prevalence.

Lower seroprevalences were reported byIsloor et al. (1998), 1.8 %; Mishra et al. (2005),4.18 percent; Bhattacharya et al. (2005), 11.94 %;and Agarwal et al. (2007), 4.6 %, while theprevalence found in the present study was lowerthan that observed by Chauhan et al. (2000),38.9 % in North Gujarat region of India,Chandramohan et al. (1992) 21.74 %.

The seroprevalences determined by varioustests differed from one another. This could be dueto variation in the numbers of false positives andfalse negatives detected by various tests. Similarfindings were reported by Rao et al. (1999) andSingh et al. (2004).

In the present study, RBPT shows 64.58 %sensitivity and 99.50 % specificity when comparedwith i-ELISA. This is in agreement with Uzal et al.(1995) and Saravi et al. (1995), who reported 98.9% and 99.7 % specificity, respectively. PrahladKumar et al. (1999) showed 33.33 % sensitivity;this was lower than the present findings.

Table 1. Geographical distribution of brucellosis antibodies.

74

i-ELISA RBPT STAT

District Numer of samples tested No. of samples

+ve (%) No. of samples

+ve (%) No. of samples

+ve (%)

Anand 78 16 (20.51) 11 (14.10) 9 (11.53)

Vadodara 27 2 (7.40) 2 (7.40) 2 (7.40)

Ahemdabad 86 20 (23.26) 13 (15.11) 12 (13.95)

Kaira 60 10 (16.67) 6 (10.00) 5 (8.34)

TOTAL 251 48 (19.12) 32 (12.74) 28 (11.16)


STAT showed 56.25 % sensitivity and99.50 % specificity when compared with i-ELISA.Higher sensitivity (81.81 %) was observed byAgrawal and Batra (1999). Prahlad Kumar et al.(1999) reported more than 90 % specificity. Therelative sensitivity of RBPT was 64.58 % and thatof STAT was 56.25 %. The relative specificityobserved was more than 99.00 % in the above case.Thus, i-ELISA test in conjunction with otherserological tests can give more reliable diagnosis.

REFERENCES

Agarwal, R., M. Kumar and J.L. Singh. 2007.Seroprevalence of brucellosis in Uttranchal.Indian Vet. J., 84: 204-205.

Agrawal, G.S. and H.V. Batra. 1999. Comparisionof an inhibition enzyme linked immunosorbentassay with other serological tests for detectionof antibodies to Brucella. Indian Vet. J., 76:10-12.

Araj, G.F. 1999. Human brucellosis: a classicalinfectious disease with persistent diagnosticchallenges. Clin Lab Sci., 12: 207-212.

Bhattacharya, D.K., K. Ahmed and H. Rahman.2005. Studies on seroprevalence of bovinebrucellosis by different tests. J. Vet. Pub.Hlth., 3: 131-133.

Chandramohan, C.P., P. Ramdass and N. Raghavan.1992. Studies on bovine brucellosis in anendemic area. Indian Vet. J., 69: 581-583.

Chatterjee, B.N., J. Bidyanata, M. Chakraborty, P.Mondal and G.P. Sen. 1984. Sero-epidemiological studies on bovine brucellosisin organized herds in West Bengal. Indian J.Anim. Sci., 55: 249-252.

Chauhan, H.C., B.S. Chandel and N.M. Shah. 2000.Seroprevalence of brucellosis in buffaloes ofGujarat. Indian Vet. J., 77: 1105-1106.

Hobbs, I.F. 1985. Comparision of indirect enzymelinked immunosorbent assay (ELISA) with thecomplement fixation test (CFT) forserodiagnosis of bovine brucellosis. N.Z. Vet.J., 33: 112-116.

Isloor, S., G.J. Renukaradhya and M. Rajshekhar.1998. A serological survey of bovinebrucellosis in India. Rev. Sci. Tech., 17: 781-785.

Nielsen, K., P. Smith, D. Gall, Perez, C. Cosma, P.Mueller, J. Trottier and J. Bosse. 1996.Development and validation of an indirectenzyme linked immunosorbent assay fordetection for detection of antibody to Brucellaabortus in milk. Vet. Microbiol., 52: 165-173.

Orduna, A., A. Almaraz and A. Prado. 2000.Evaluation of an immunocapture-agglutinationtest (Brucellacapt) for serodiagnosis of humanbrucellosis. J. Clin. Microbiol., 38: 4000-4005.

Prahlad Kumar, D.K. Singh and S.B. Barbuddhe.1999. Seroprevalence of brucellosis andcomparision of serological test to diagnosis itin buffaloes. Buff. J., 15: 361-370.

Rao, S.T., V. Rama Devi, R. Madhu Babu AndA.V.C. Narsinha Rao. 1999. Comparision ofrapid plate agglutination, standard tubeagglutination and dot-ELISA tests fordetection of antibodies to Brucella in bovines.Indian Vet. J., 76: 255-256.

Romero, C., C. Gamazo, M. Pardo and I. Lo’pez-gon. 1995. Specific detection of BrucellaDNA by PCR. J. Clin. Microbiol., 33: 615-617.

Saravi, M.A., P.P. Wright, R.J. Gregort and D.E.Gall. 1995. Comparative performance of theenzyme linked immunosorbent assay (ELISA)and conventional assays in the diagnosis ofbovine brucellosis in Argentina. Vet. Immunol.Immunopathol., 47: 93-99.

Sharma, J.K. and S.S. Saini. 1995. Seroprevalenceof brucellosis among farm animals of Punjab.Indian Vet. J., 72: 881-882.

Singh, G., D.R. Sharma and N.K. Dhand. 2004.Seroprevalence of bovine brucellosis inPunjab. Indian Vet. J., 81: 620-623.

Uzal, F.A., A.E. Carrasco, S. Echaide, K. Nielsenand C.A. Robles. 1995. Evaluation of indirectELISA for the diagnosis of bovine brucellosis.J. Vet. Digan. Invest., 7: 473-475.

Yagupsky, P. 1999. Detection of Brucella in bloodcultures. J. Clin. Microbiol., 31: 1927-1931.

75

∼


DETECTION OF BOVINE HERPESVIRUS 1 (BHV-1) INFECTION IN SEMEN OF INDIANBREEDING BULLS BY POLYMERASE CHAIN REACTION AND ITS CHARACTERIZATION

BY DNA SEQUENCINGJain Lata1, A.N. Kanani2, J.H. Purohit2, C.G. Joshi2, D.N. Rank2,

Vinay Kumar3 and V.K. Jain2

1Division of Biological Standardization, IVRI, Izatnagar, UP, India2Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, Anand, GujaratState, India3Directorate on medicinal and Aromatic Plants, Anand, Gujarat, India

ABSTRACT

Bovine herpesvirus 1 (BHV-1), thecausative agent of infectious bovine rhinotracheitis(IBR), is considered to be the most common viralpathogen found in bovine semen. BHV-1 isassociated with several clinical conditions, includinginfectious bovine rhinotracheitis, infectious pustularvulvovaginitis, balanoposthitis, conjunctivitis andgeneralized disease in newborn calves, causing greateconomic loss to the livestock industry. A total of101 semen samples from breeding bulls of differentArtificial Insemination Centres were screened forthe presence of viral genome by employing PCRusing two sets of primers viz., gB1/gB2 and gC1/gC2 from gB and gC genes coding for viral envelope.Viral DNA was extracted from semen usingQIAamp DNA Mini Kit and was then subjected toPCR. In gB gene based PCR, 47 (46.53 %) semensamples were found to be positive, producing anamplified PCR product of size 478 bp. While in gCgene based PCR, 43 (42.57 %) were found to bepositive for presence of viral genome, producing anamplified PCR product of size 173 bp. In comparisonof the efficacy of the primers, the results of thesetwo primers were in agreement for 95 samples outof the 101 tested samples. Thus, both the primerscan be applied effectively in detection of BHV-1DNA in semen. In sequencing of gB-gene basedPCR products, a consensus sequence of 459 bp wasobtained. The sequences of field isolates matchedcompletely with the sequence of BHV-1.1. Finally,the study revealed the presence of BHV-1 in thesemen of breeding bulls of Gujarat. Thus, under theSexual Health Control Programme proper measures

must be taken at the State level for controlling BHV-1 infection. The bulls must be free from BHV-1infection prior to use.

Keywords: BHV-1, breeding bulls, semen, gB gene,gC gene, PCR, sequencing

INTRODUCTION

Bovine herpesvirus type 1 (BHV-1) is amember of the Alphaherpesvirinae. BHV-1 infectsthe respiratory and genital tracts of cattle andbuffaloes, causing various diseases, such asinfectious bovine rhinotracheitis, infectious pustularvulvovaginitis, and infectious pustular balanoposthitis,abortion, mastitis, infertility, tracheitis, conjunctivitis-keratoconjunctivitis, encephalitis and fatal diseasein newborn calves, and thus causing great economiclosses to the livestock industry (Gibbs andRweyemamu, 1977).

Bovine herpesvirus-1 infection was firstreported in India by Mehrotra et al., 1976 andvarious workers have since reported the widespreadseroprevalence and isolation of the virus, which theyhave isolated in different parts of the country (Samalet al., 1981; Renukaradhya et al., 1996). Theinfection has serious economic implications for India,which is emerging as the world’s biggest milkproducer and has the world’s largest cattle andbuffalo population.

Transmission of the virus is thought to occurprimarily via the respiratory route. However, thevirus can also be transmitted venereally and byBHV-1 contaminated semen from virus-shedding

76


bulls (Kupferschmied et al., 1986 and Afshar andEaglesome, 1990). Bulls may shed virus in semenduring both clinical and subclinical infections (vanOirscholt et al., 1993). After genital infection andseroconversion, BHV-1 localizes and persists,latently, in sacral ganglia (Ackermann and Wyler,1984). Shedding of virus reoccurs during periodicreactivation of viral replication. Viral reactivationfrom the latent state is generally thought to be stress-induced but can also be induced by the injection ofcorticosteroids (Pastoret et al., 1980). The use ofsemen from BHV-1 infected bulls necessitates theidentification of BHV-1 contaminated semensamples to prevent transmission of virus to therecipient cow. To prevent the transmission ofBHV-1 by artificial insemination, only semen that isfree of BHV-1 should be used. The virus is excretedthrough secretions (nasal and ocular), and is presentin the placenta of aborted animals and semen. Bovinesemen is stored and handled in conditions that areideal for preserving the viral pathogen, socontaminated semen presents a potential threat tothe cattle industry: BHV-1 can spread throughartificial insemination (AI), causing a variety ofgenital tract disorders, such as endometritis, infertilityand abortion

van Engelenburg et al., 1993 detected mostBHV-1 DNA in seminal fluid, and virtually no BHV-1 DNA was present in the sperm head fraction,confirming the current view on the way that bovinesemen becomes contaminated with BHV-1.

The present methods of BHV-1 detectionin diagnostic laboratories are by virus isolation (VI),fluorescent antibody tests (FAT) of tissues, andscreening for specific antibodies either in pairedserum samples or single serum samples. Virusisolation is laborious, expensive, has a long turnaroundtime and requires fresh materials. The fluorescentantibody test is insensitive and requires goodimmunological reagents, which are not easilyavailable. The test for seroconversion takes aminimum of 14 to 21 days, and some latently infectedanimals may have low antibody titer that may notbe detected using the current serological procedures.In recent years, efforts have been made to exploitthe detection of viral genetic material in the field ofdiagnostic virology. Polymerase chain reaction(PCR) is one of the DNA manipulation techniques

that have stimulated strong interest in this area.Various PCR assays for the recognition of BHV-1have been described. Primers were selected toamplify parts of the gB gene (Vilcek, 1993; Lyakuet al., 1996 and Santurde et al., 1996), the gC gene(Galeota et al., 1997 and van Engelenburg et al.,1995), the gD gene (Wiedmann et al., 1993 and Geeet al., 1996), and the thymidine kinase gene of BHV-1 (Kibenge et al., 1994) with various sensitivities.


Reference virus and semen samples:IBR seed virus (7th passage) was procured fromPD-ADMAS, Bangalore. The virus was processedfor 8th and 9th passages at Disease Investigation andMonitoring Laboratory, NDDB, Anand. This 9th

passage IBR seed virus was used as reference virusDNA extraction and PCR. A total of 101 semensamples were collected from cattle (49 samples)and buffalo breeding bulls (52 samples) of fivedifferent AI centres of Gujarat. Samples werecollected in screw-capped plastic vials andtransported on ice to the laboratory and were storedat -80 oC for future use.

DNA extraction: DNA extraction fromseed virus as well as semen samples was carriedout as per the manufacturer’s protocol usingQIAamp DNA Mini Kit (Catalog no. 51304, QiagenPvt. Ltd). The eluted DNA was stored at -20 oC forlong term use.

Polymerase Chain Reaction:Primers: Two pairs of primers, gB1 F (52 -

TAC GAC TCG TTC GCG CTC TC-32 ), gB2 R(52 -GGT ACG TCT CCA AGC TGC CC-32 ) andgC1 F (5'-CTG CTG TTC GTA GCC CAC AACG-3') /gC2 R(5'-TGT GAC TTG GTG CCC ATGTCG C-3') (synthesized by MWG Biotech AG,Germany) were used for PCR amplification. gB1/gB2 primer was selected according to the DNAsequence published for glycoproteins gB (BHV-1.1Cooper; accession no. M21474) by Fuchs et al.,1999, and was predicted to produce a PCR productof 478 base pairs (bp). gC1/gC2 primer sequencesare based on the sequence of the BHV-1

77


glycoprotein C (gpC) gene as used by Engelenburget al., 1993.

Conditions of PCR: PCR was carried outin a final reaction volume of 25 μl using a 200 μlcapacity thin wall PCR tube (Axygen). PCR wasperformed in a 25 μl volume containing 12.5 μl hotstart PCR master mix (Catalog no. 203443, Qiagen),1 μl of each primer (10 pmol/μl), 3 μl of extractedDNA and 7.5 μl of DNAse free water. Theamplification was performed in a thermal cycler(MyCycler, Bio-Rad, USA); cycling conditionsconsisted of an initial denaturation step at 95 oC for15 minutes, followed by 35 cycles of 96 oC for1 minute, 65 oC for 45 sec, 72 oC for 45 sec and afinal extension at 72 oC for 10 minutes for gB1/gB2primer and a initial denaturation step at 95 oC for 15minutes, followed by 38 cycles of 95 oC for 1 minute,60 oC for 1 minute, 72 oC for 1 minute and a finalextension at 72 oC for 10 minutes for gC1/gC2primer. The negative control consisted of sterilewater instead of DNA template while positive controlconsist of DNA extracted from reference virusspiked with neat semen. After amplification, 5 μl ofthe reaction mixture was electrophoresed in a2.0 % agarose gel, stained with ethidium bromide.The amplified product was visualized as a singlecompact band of expected size under UV light anddocumented by a gel documentation system (SynGene,Gene Genius BioImaging System, UK). Aclear, compact band of 478 and 173 bp, respectively,for gB1/gB2 and gC1/gC2 primers was regardedas a positive result.

Sequencing of the gB Gene Segment:Purification of PCR products for

sequencing: PCR products amplified from the gBgene (478bp) using gB1/gB2 primer pair werepurified in low melting point agarose -Nusieve GTGagarose (Cat. No.50080, BioWhittakar MolecularApplications, USA) following the method describedby Sambrook and Russel (2001). Twenty microlitresof the PCR-amplified products of representativefield sample was electrophoresed (60 mV for twohour) along with 100 bp DNA molecular weightmarker (GeneRuler, MBI Fermentas) on a 2 % (W/V) low melting point agarose gel in 1X TAE (TAE50X composition: Tris base - 242 g; Glacial aceticacid - 57.1 ml; 0.5 M EDTA (pH 8.0) - 100 ml;

Deionized water up to 1000 ml) and stained withethidium bromide (0.5 μg/ml of 1X TAE buffer).The DNA band of interest (478bp) was visualizedon a UV Trans-illuminator. Using a sharp razorblade, a slice of agarose containing the bands ofinterest was cut out and transferred into a cleanmicrofuge tube and was incubated in five volumesof LMT elution buffer (Tris base - 0.12 g; EDTA- 0.0075 g; Deionized water up to 50 ml) at 72 oCfor 10 minutes. Then an equal volume of equilibratedphenol was added and then the aqueous phase wasrecovered by centrifugation at 11000 rpm for 10minutes. The aqueous phase was extracted oncewith Phenol: Chloroform (1:1, v/v) and once withchloroform. The aqueous phase was transferred toa fresh tube, then to it was added 0.1 volume of 3 Msodium acetate and two volumes of chilled absoluteethanol, and then DNA was pelleted bycentrifugation at 11000 rpm for 20 minutes at 4 oC.The DNA pellet was washed twice with 70 %ethanol. The pellet was air dried for 30 minutes andthen dissolved in 20 μl of TE buffer [Tris base-0.06 g; EDTA- 0.0075 g; Deionized water up to50 ml (pH 8.0)]. The concentration of the purifiedPCR product was determined and subjected to cyclesequencing.

Cycle sequencing: Cycle sequencing wasperformed following the instructions supplied alongwith BigDye R Terminator v3.1 Cycle SequencingKit. The reaction was carried out in a final reactionvolume of 20 μl in thermal cycler containing 1.00 μlof Ready reaction premix, 3.50 μl of Big dyesequencing buffer (5X), 2.00 μl of gB specificprimer- forward or reverse each in separate tubes(1.6 pmol/μl), 2.00 μl of PCR product, 0.5 μl of Hotstart taq polymerase (5U/μl), 2.00 μl of Hot startbuffer (10X) and 9.00 μl of deionized water. Thecycling protocol included: initial denaturation at95 oC for 5 minutes, denaturation at 95 oC for 30seconds, annealing at 50 oC for 10 seconds, andextension at 60 oC for 4 minutes and was designedfor 25 cycles with the thermal ramp rate of 1oC persecond. After the cycling, the extension productswere purified. The extension product (20 μl) wasmixed with two μl of 125 mM EDTA, two μl of 3 Msodium acetate and 50 μl of 100 % ethanol andincubated at room temperature for 15 minutes andthen centrifuged at 3000 g for 30 minutes at 4 oC.

78

O


with 70 µl of 70 % ethanol by centrifuging at 1650 gfor 15 minutes at 4 oC. Finally, the pellet was driedand resuspended in 10 µl formamide (Sigma Aldrich,USA, Cat No. F-9037) and was heated at 95 oC fortwo minutes, snap chilled, vortexed and spun briefly.The samples were stored on ice until ready to loadinto the instrument. The samples were transferredto 0.5 ml sample tube and subjected to automatedDNA sequencing on ABI PRISM R 310 GeneticAnalyzer (Applied Biosystems, USA) for capillaryelectrophoresis through the performance optimizedpolymer (POP-6TM) (Part No. 402837 AppliedBiosystems, USA) and data analysis. The nucleicacid sequences of the gB gene PCR products werealigned with known sequences of BHV-1 availablein Genbank.

RESULTS

PCR: In the present study, the BHV-1genome was detected by using the gB and gC genebased primers. By using the gB gene based primer,reference virus as well as 47 (46.53 %) out of 101semen samples, produced an approximately 478 bpamplicon (Figure 1 and Table 1). Similarly while usingthe gC gene based primer, reference virus as wellas 43 (42.57 %) out of 101 semen samples producedan approximately 173 bp amplicon (Figure 2 andTable 1).

Comparative efficiency of two primers:Two primer pairs viz., gB1/gB2 amplifying a region

Table 1. Detection of BHV-1 genome in semen of bulls by gB and gC gene based PCR.

79

O

Attributes Numbers tested

Number positive by

gB gene PCR

Percentpositive by

gB gene PCR

Number positive by

gC gene PCR

Percentpositive by

gC gene PCR

[A] Centre/Location: I. Himmatnagar 11 0 0.00 0 0.00 II. Surat 14 4 28.57 5 35.71 III. Rajkot 21 14 66.67 11 52.38 IV. Mahesana 51 26 50.98 24 47.06 V. Anand 04 3 75.00 3 75.00

Total 101 47 46.53 43 42.57 [B] Specieswise: Cattle 49 23 46.93 20 40.81 Buffalo 52 24 46.15 23 44.23

Total 101 47 46.53 43 42.57 [C] Breedwise (Cattle) : Cross bred 39 15 38.46 13 33.33 Gir 10 8 80.0 7 70.0

Total 49 23 46.93 20 40.81 [D] Breedwise (Buffalo): Mahesani 38 18 47.36 17 44.73 Jafrabadi 7 4 57.14 3 42.85 Surti 7 2 28.57 3 42.85

Total 52 24 46.15 23 44.23


Table 2. Comparison of gB-PCR and gC-PCR.

Table 3. Score table for alignment of 459 bp sequence of BHV-1 field isolates Meh/Guj/ibr with sequence published in Gene bank.

Figure 1. Agarose gel electrophoresis pattern of BHV-1 gB gene 478 bp specific PCR product amplified with primer gB1/gB2.

La : DNA molecular weight ladder of 100 bp-Ve : Negative Control+Ve : Positive Control (Reference Virus)01-12 : Field Samples

80

gB gene based PCR Test Positive Negative Total

Positive 42 01 43 gC gene based PCR Negative 05 53 58

Total 47 54 101

SeqA Name Length(nt) SeqB Name Length(nt) Score 1 Meh/Guj/ibr 459 2 BHT1UL 459 100 1 Meh/Guj/ibr 459 3 BHV1CGEN 459 100 1 Meh/Guj/ibr 459 4 HSBGPI 459 100 1 Meh/Guj/ibr 459 5 HSB1GPB 459 99 2 BHT1UL 459 3 BHV1CGEN 459 100 2 BHT1UL 459 4 HSBGPI 459 100 2 BHT1UL 459 5 HSB1GPB 459 99 3 BHV1CGEN 459 4 HSBGPI 459 100 3 BHV1CGEN 459 5 HSB1GPB 459 99 4 HSBGPI 459 5 HSB1GPB 459 99


of the gB gene and gC1/gC2 amplifying a region ofthe gC gene were compared for their efficiency indetection of the BHV-1 genome from the fieldsamples. A total of 101 semen samples were testedwith both the primers. Primer set gB1/gB2 producedthe desired amplicons of 478 bp in 47 samples whileprimer set gC1/gC2 produced the desired ampliconsof 173 bp in 43 samples. A total of 42 and 53 samples,respectively, were found positive and negative withboth the primers. While five samples found positive

Figure 2. Agarose gel electrophoresis pattern of BHV-1 gB gene 173 bp specific PCR product amplified with primer gC1/gC2.

La : DNA molecular weight ladder of 100 bp-Ve : Negative Control+Ve : Positive Control (Reference Virus)01-09 : Field Samples

Figure 3. Consensus sequence of 459 bp submitted in NCBI genbank under Accession no. EF175730.

Meh/Guj/ibr >TCGCGCTCTCGACCGGGGACATTATCTACATGTCGCCCTTTTACGGGCTGCGCGAGGGCGCGCACCGCGAGCACACCAGCTACTCGCCGGAGCGCTTCCAGCAGATCGAGGGCTACTACAAGCGCGACATGGCCACGGGCCGGCGCCTCAAGGAGCCGGTCTCGCGGAACTTTTTGCGTACACAGCACGTGACGGTAGCCTGGGACTGGGTGCCCAAGCGCAAAAACGTGTGCTCGCTGGCCAAGTGGCGCGAGGCGGACGAAATGCTGCGAGACGAGAGCCGCGGGAACTTCCGCTTCACGGCCCGCTCGCTCTCGGCGACCTTTGTGAGCGACAGCCACACCTTCGCGTTGCAGAATGTGCCGCTGAGCGACTGCGTGATCGAAGAGGCCGAGGCCGCGGTCGAGCGCGTCTACCGCGAGCGCTACAACGGCACGCACGTGCTGTCGGGCAGCTTGG<

by primer set gB1/gB2 were found negative byprimer set gC1/gC2 and only one sample foundpositive by primer set gC1/gC2 was found negativeby primer set gB1/gB2. Thus, the results of thesetwo primers were in agreement for 95 samples outof the 101 tested samples (Table 2).

Sequencing of the gB gene PCRamplified product: In the present study, a sequenceof 462 bp was obtained by using forward primerwhile a sequence of 445 bp was obtained by using

81


reverse primer. The reverse sequence wasconverted to reverse complement sequence. Thecurrated sequence obtained by using forward andreverse primers were assembled using SeqScapev2.5 software programme and a consensus sequenceof 459 bp was obtained (Figure 3).

DISCUSSION

PCR: In the present study, the BHV-1 viralgenome was detected in 47 and 43 samples out of100 semen samples by using gB gene and gC genebased primers, respectively. This gB gene basedprimer was developed by Fuchs et al. (1999), andthey obtained product of 478 bp with this primerfrom different strains of BHV-1 and used this primersucessfully for detection of BHV-1 DNA inperipheral blood of naturally infected cattle.

This gC gene based primer was developedby van Engelenburg et al. (1993) using the computerprogramme of Lowe et al. (1990). They examinedthe coding region of the BHV-1 gC gene and selecteda primer pair with an expected product length of173 bp. They tested 18 different BHV-1 isolates byPCR using the selected primer to test whether thePCR target was conserved among BHV-1 strains.A specific product of 173 bp was obtained from eachof the above 18 isolates tested. On the basis of theresults of both the primers, BHV-1 was more orless equally distributed both in cattle and buffalobulls.

Gee et al. (1996) detected BHV-1 in alimited number of semen samples only using PCR;however, they detected BHV-1 in 23 out of 100 nasalswabs using PCR. Wagter et al. (1996) developedand evaluated a PCR assay using a primer of thegD gene and compared it with virus isolation fromnon extended semen of experimentally infected bulls.Of a total 162 ejaculates, 51 were found positive byvirus isolation and 73 by PCR, thus proving PCRmore sensitive as compared to virus isolation. Rola(2002) detected the presence of BHV-1 in 7.4 %and 10.7 % semen samples, respectively, for gC andgD primers using PCR technique thus observed

minor difference between two primers. Deka etal. (2005) found 14 positive out of 24 semen samplesby using a primer of the gI gene amplifying a productof 468 bp. Similarly other workers viz., vanEngelenburg et al. (1993), Wiedmann et al. (1993),van Engelenburg et al. (1995), Masri et al. (1996)and Gupta et al. (2006) developed PCR using primersof different regions for detection of BHV-1 insemen.

Sequencing of gB gene PCR amplifiedproduct: To prove the specificity and authenticityof the PCR products, products (478 bp) of BHV-1genome amplified by gB1/gB2 primers fromrepresentative sample were subjected using forwardand reverse primer of gB gene in seperate PCRtubes for sequencing by ABI PRISM R 310 GeneticAnalyzer. In the present study, a consensus sequenceof 459 bp was obtained (Figure 3). This consensussequence was then further used for alignment withthe published sequence of BHV-1 in Genbank usingNCBI Blast and CLUSTAL W (1.82) software andSeqScape v2.5 software.

Sequence analysis: The consensussequence of 459 bp (named as Meh/Guj/ibr) obtainedfrom forward and reverse primer cycle sequencingwas aligned with known sequences BHT1UL(Accession no. Z78205.1), BHV1CGEN (Accessionno. AJ004801.1), HSBGPI (Accession no.M21474.1) and HSB1GPB (Accession no.M23257.1) of BHV-1 published in GenBank. Thesequence and alignment homology scores for fieldsample are presented in Table 3. The consensussequence of 459 bp was submitted in NCBI genbankunder Accession no. EF175730.

The amplified parts of the gB gene werefound to be 100 % identical to the publishedsequences of BHT1UL (Accession no. Z78205.1),BHV1CGEN (Accession no. AJ004801.1), HSBGPI(Accession no. M21474). Compared to HSB1GPB(Accession no. M23257) the sequence of theamplified gB region of field isolate differed at onenucleotide (99 % identity), which also led to onedifferent amino acid (the amino acid at position 114;S to T). The sequences of field isolate matchedcompletely with the sequence of BHV-1.1. A similar

82

O


Deka, D., Ramneek, N.K. Maiti and M.S. Oberoi.2005. Detection of bovine herpesvirus-1infection in breeding bull semen by viusisolation and polymerase chain reaction. Rev.Sci. Tech. Off. Int. Epiz., 24: 1085-1094.

Fuchs, M., H. Peter, Jan Detterer and R. HannsJoachim. 1999. Detection of bovineherpesvirus type 1 in blood from naturallyinfected cattle by using a sensitive PCR thatdiscriminates between wild-type virus andvirus lacking glycoprotein E. J. Clin.Microbiol., 37: 2498-2507.

Galeota, J.A., E.F. Flores, S. Kit, M. Kit and F.A.Osorio, 1997. A quantitative study of theefficacy of a deletion mutant bovineherpesvirus-1 differential vaccine in reducingthe establishment of latency by wildtype virus.Vaccine, 15: 123-128.

Gee, De A.L.W., L.H.A. Wagter and J.J. Hage.1996. The use of polymerase chain reactionassay for the detection of bovine herpesvirus1 in semen during a natural outbreak ofinfectious bovine rhinotracheitis. Vet.Microbiol., 53: 163-168.

Gibbs, E.P.J. and M.M. Rweyemamu. 1977. Bovineherpesviruses. Part I. Bovine herpesvirus 1.Vet. Bull., 47: 317-343.

Gupta, P.K., M. Saini and A. Rai. 2006. Rapid andsensitive PCR- based test for detection ofbovine herpesvirus-1 in semen. Indian J.Virol., 17: 23-27.

Kibenge, F.S., L.M. Harris, P.K. Mckenna, D.Wadowska and C.V. Yason. 1994.Amplification of strains of bovine herpesvirus1 by use of polymerase chain reaction withprimers in the thymidine kinase region. Amer.J. Vet. Res., 55: 1206-1212.

Kupferschmied, H.U., U. Kihm, P. Bachmann, K.H.Muller and M. Ackermann. 1986.Transmission of IBR/IPV virus in bovinesemen: a case report. Theriogenology, 25:439-443.

Lowe, T., J. Sharefkin, S.Q. Yang and C.W.Dieffenbach. 1990. A computer program forselection of oligonucleotide primers forpolymerase chain reactions. Nucl. Acid. Res.,18: 1757-1761.

result was also reported by Fuchs et al. (1999) forthe same PCR fragment of 478 bp.

CONCLUSION

Finally, the study revealed the presence ofBHV-1 in the semen of breeding bulls of Gujarat.Thus, under the Sexual Health Control Programme,proper measures must be taken at the State levelfor controlling BHV-1 infection. The 46.72 %positivity for IBR virus in semen by PCR in thisstudy was not surprising and directs our attentiontowards the alarming situation in the state.Considering the fact than BHV-1 is capable oftransmission through artificial insemination, this isan alarming condition for the Gujarat State.Therefore, the results of this study should be takenas an indicator of infection foci and warrant carryingout large-scale state-wide surveys using appropriatesampling techniques for a meaningful assessmentof the disease situation in the bovine population thatwill be helpful in planning the state level controlprogrammes. Thus under the Sexual Health ControlProgramme, proper measures must be taken at theState level for controlling BHV-1 infection. Allbreeding bulls must be tested periodically fordetection of the presence of BHV-1 in semen. Thebulls must be free from BHV-1 infection prior touse.

ACKNOWLEDGEMENTS

The authors are thankful to the Inchargesof different AI Centres of Gujarat State for providingsemen samples for this study.

REFERENCES

Ackermann, M. and R. Wyler. 1984. The DNA ofan IPV strain of bovid herpesvirus 1 in sacralganglia during latency after intravaginalinfection. Vet. Microbiol., 9: 53-63.

Afshar, A. and M.D. Eaglesome, 1990. Virusesassociated with bovine semen. Vet. Bull., 60:93-109.

83


Lyaku, J.R.S., S. Vilcek, P.F. Nettleton and H.S.Marsden. 1996. The distinction of serologicallyrelated ruminant alphaherpesviruses by thepolymerase chain reaction (PCR) andrestriction endonuclease analysis. Vet.Microbiol., 48: 135-142.

Masri, S.A., W. Olson, P.T. Nguyen, S. Prins andD. Deregt. 1996. Rapid detection of bovineherpes 1 in the semen of infected bulls by anested polymerase chain reaction assay. Can.J. Vet. Res., 60: 100-107.

Mehrotra, M.L., B.S. Rajya and S. Kumar. 1976.Infectious bovine rhinotracheitis (IBR)-keratoconjunctivitis in calves. Indian J. Vet.Pathol., 1: 70-73.

Pastoret, P.P., L.A. Babiuk, V. Misra and P. Griebel.1980. Reactivation of temperature sensitiveand non-temperature sensitive infectiousbovine rhinotracheitis vaccine virus withdexamethasone. Infec. Immunity, 29: 483-488.

Renukaradhya, G.J., M. Rajasekhar and R.Raghavan. 1996. Prevalence of infectiousbovine rhinotracheitis in Southern India. Rev.Sci. Tech. Off. Int. Epiz., 15: 1021-1028.

Rola, J. 2002. Application of PCR assay for detectionof BHV-1 virus with bull semen. Postep.Mikrobiol., 41: 45-49.

Samal, S.K., B.B. Mallick and S.K. Das. 1981. Noteon the incidence of infectious bovinerhinotracheitis virus infection among cattle inIndia. Indian J. Anim. Sci., 51: 895-897.

Sambrook, J. and D.W. Russel. 2001. MolecularCloning: A Laboratory Manual, 3rd ed. Cold

Spring Harbor Laborartory, Cold SpringHarbor, New York.

Santurde, G., N. Da Silva, R. Villares, E. Tabares,A. Solana, J.M. Bautista anf J.M. Castro.1996. Rapid and high sensitivity test for directdetection of bovine herpesvirus-1 genome inclinical samples. Vet. Microbiol., 49: 81-92.

van Engelenburg, F.A.C., R.K. Maes, J.T. vanOirschot, F.A.M. Rijsewijk. 1993.Development of a rapid and sensitivepolymerase chain reaction assay for detectionof bovine herpesvirus type 1 in bovine semen.J. Clin. Microbiol., 31: 3129-3135.

van Engelenburg, F.A.C., F.W.V. Schie, F.A.M.Rijsewijk and J.T. van Oirschot. 1995.Excretion of bovine herpesvirus 1 in semen isdetected much longer by PCR than by virusisolation. J. Clin. Microbiol., 33: 308-312.

van Oirscholt, J.T., P.J. Straver, A.H. van Lieshout,J. Quak, F. Westenbrink and A.C.A. vanExsel. 1993. A subclinical infection of bullswith bovine herpesvirus type I at an artificialinsemination centre. Vet. Rec., 132: 32-35.

Vilcek, S. 1993. Detection of bovine herpesvirus-1(BHV-1) genome by PCR. J. Virol. Meth.,41: 245-248.

Wagter, L.H.A., R.D. Glas, N. Bleumink Pluym,F.A.C. van Engelenburg, F.A.M. Rijsewijk andD.J. Houwers. 1996. A polymerase chainreaction (PCR) assay for detection of bovineherpesvirus-1 (BHV-1) in selectively digestedwhole bovine semen. Vet. Res. Commun., 20:401- 408.

Wiedmann, M., R. Brandon, P. Wagner, E.J. Duboviand C.A. Batt. 1993. Detection of bovineherpesvirus-1 in bovine semen by a nestedPCR assay. J. Virol. Meth., 44: 129-139.

84


QUANTITATION OF SERUM IMMUNOGLOBULINS OF NEONATAL BUFFALO CALVESAND COW CALVES THROUGH ELISA AND PAGE:

STATUS OF IMMUNE-COMPETENCEBarmaiya, S.1, Aditi Dixit1, A. Mishra1, A.K. Jain2, A. Gupta3, A. Paul3,

M.A. Quadri3, A.K. Madan4 and I.J. Sharma1

1Department of Physiology, College of Veterinary Science & AH, Jabalpur 482001 (M.P), India2Department of Physiology, College of Veterinary Science and Animal Husbandry J.N.K.V.V. Jabalpur (M.P.)482001, India3Department of Biochemistry, College of Veterinary Science & AH, Jabalpur 482001 (M.P), India4G.B. Pant University of Agriculture & Tech., Pantnagar, Uttaranchal, India

ABSTRACT

In order to explore the features of theimmune system, sera samples of neonatal buffalocalves (24) and cow calves (24) were processedfor ELISA of IgM, IgG and IgA. PAGE of theimmunoglobulins of the sera samples was conductedto separate the different types of immunoglobulins.The levels of all the types of immunoglobulinsincreased with age of the calves in serum aftercolostrum feeding and the degree of elevation washigher for IgG and IgA. The overall enhancementrecorded was greater in the cow calves than in thebuffalo calves. The increment in the concentrationof immunoglobulins was significant (P< 0.05) within6 days postcolostral feeding; thereafter, a consistencywas maintained, except for IgG, which was alwaysat higher levels. Overall, to begun with, five bandswere recorded in PAGE, of which the first bandwas conspicuous. The other bands might have beenthe fragmented forms of IgD and IgA indicative ofpoor immunity at the time of birth. The sixth bandappeared in PAGE along with consolidation of otherbands in terms of density at 15 days postcolostralfeeding, indicating the building up of the immunesystem. After about 60 days of age, the molecularweight and density of the bands increased. This isindicative of the polymerization of immunoglobulins.The immunomodulators like neem oil and withaneloidalso enhanced the polymerization of immu-noglobulins. Finally, it was evident from the datadeveloped that the amount and molecular weight ofeach immunoglobulin type increased withconsolidation by the 90th day of age of the calves. It

was concluded that the buffalo calves not only hadpoor immunocompetence, but also had poor responseto the immunity-boosters as compared to the cowcalves. Among the immunoregulators used, neemoil could be recommended as an effective and cheapimmunity-booster for buffalo calves.

Keywords: immunoglobulins quantitation, neonatalcalves, immune-competence, immunomodulators

INTRODUCTION

Development of the internal defense startswith development of the nervous system duringorganogenesis. The parasympathetic nervous systembeing anabolic is immunogenic whereas thesympathetic nervous system is immunodepressant,being catabolic in function. At the time of birth, thedevelopment of the whole of the autonomic nervoussystem is slow and so the defense system.Expression of the genes responsible for synthesisand secretion of immunoglobulins on roughendoplasmic reticulum (Richard et al., 2000) is acomplex phenomenon. The neonatal buffalo calvesare almost agammaglobulinaemic at the time of birth(Jain et al., 2007). It has been further emphasizedthat the colostrum of newly calved buffaloes containgreater amounts of immunoglobulins than cowcolostrum, and the reverse is true for the serasamples (Jain et al., 2007). The IgG is effectiveagainst micro-organisms present in the mouth andgastrointestinal tract. IgM is the first antibodyproduced in the body by activated B cells and is

85


especially effective in activating the complementsystem proteins to kill micro-organisms. IgD isrelated in recognition of B lymphocytes by antigensand induces B cells to proliferate and form clonesfor production of different immunoglobulins (Richardet al., 2000 and Ganong, 2005). In newborns of thedomestic animals, the plasma gamma- globulins areeither lacking or present only as traces since theplacenta is not permeable for these immunoglobulins.

Some interesting yet incomplete informationis available with regard to the composition of thebuffalo’s vis-a-vis the cow’s colostrum and milk andtheir effects on the mortality of calves. Detailedinformation with regard to the levels ofimmunoglobulins in the neonatatal period and theirrelationship with the internal resistance of buffalocalves as compared to cow calves may unravel thehidden facts. Neem oil and withaneloide have verygood immuno-modulating activities (Jain et al., 2006)and hence, their use in the calves has been explored.


AnimalsThe sera samples of 24 neonatal buffalo

calves and 24 cow calves as indicated in Table 1were separated from blood collected from the 1st

day, before colostrum feeding, through the 90th dayat regular intervals. The last sample was collectedon the 91st day of age of the animals.

Quantification of important fractions ofimmuno-globulins through ELISA

The quantitative estimation of IgM, IgG andIgA was made in the sera samples of the buffalocalves and cow calves using ELISA kits (BethylLaboratories, Inc, 25043 West FM 1097,Montgomery, TX 77356).

ELISA of immunoglobulinsAn aliquot of 0.3 ml serum was diluted with

0.6 ml of PBS and an equal volume (0.9 ml) ofsaturated ammonium sulphate solution (50 %) wasadded, vortexed for 30 minutes and centrifuged at

1000G for 15 minutes at 4 oC. The precipitate waswashed with 45 % saturated ammonium sulphateand recentrifuged. The precipitate was thenredissolved in 0.3 ml of PBS and centrifuged toremove any insoluble material. The protein solutionunder test was taken in a cut-off filter and 0.3 ml ofPBS was added. After 3-4 washings, the filtrate waschecked for the presence of ammonium sulphateby adding 0.5 ml of 1 % acidified barium chloridesolution. The final precipitate was decanted and keptin eppendroff tubes.

PAGE of serum immunoglobulinsThe PAGE technique was applied for

fractionation of serum immunoglobulins as per thestandard method for confirmation of the resultsobtained through ELISA. Accurately measured0.3 ml of test serum was processed for precipitationof immunoglobulins. Sterilized Vertical GelElectrophoresis assembly was kept ready usingresolving gel solution (12 %) and stacking gel(5 %). The precipitate obtained was dissolved in0.3 ml of PBS. Twenty micro-liters of the abovesample and a standard protein marker (Bg-Pm-003-Protein Marker, Higher Range) along with the sameamount of bromophenol blue dye was loaded in eachelectrophoretic well of the gel. Electrodes wereconnected and the electrophoretic run carried outat a constant current of 30 mA until the marker dyereached almost the end of the gel. After theelectrophoretic run, the gel was removed from inbetween the glass plates and immersed in the fixingsolution for 30 minutes. After fixation, the gel wasimmersed in CBB staining solution for 2 h at roomtemperature on a slowly rotating platform. Thestaining solution was removed and the gel was keptin destining solution for 8-10 h. After destaining, thegel was kept in water and the bands were examinedand documented in Gel- Doc. System.

The whole procedure was adopted as givenby “ATTO” with certain modifications. No breakingagents like SDS and mercaptoethanol were used,as these agents caused the breakage of the differentfragments of immunoglobulins. The samples(immunoglobulin) were not heated to avoid theirfragmentation. The gel was stained for 4 h instead

86


of 2 h. 75V current and 30 mA was provided for3- 4 h. Group significance in variation of the valueswas worked out by the students ‘t’ Test (Snedecorand Cochran, 1968).


Using ELISA for quantification of IgM, IgGand IgA in the sera samples, it was revealed thatamounts of these immunoglobulins were higher inthe cow calves than in the buffalo calves (Table 3),which might be the important reason forcomparatively better resistance of neonatal cowcalves than buffalo calves. Of the estimatedimmunoglobulins, the one in maximum quantity wasIgG and the one whose concentration was least wasIgM in calves of both the species.

Serum electrophoregram (PAGE) of buffalocalves and cow calves

The normal reported characteristics of variousimmunoglobulins have been depicted in Table 2 tobe used as a reference for identification of varioustypes of the normal reported immunoglobulins.

Although, the serum levels of all of theimmunoglobulins increased with age of the calves(Tables 4-7 and Figures 1-3) after feeding of thecolostrum, the degree of elevation for IgG and IgAwas higher. Greater overall enhancement wasrecorded in cow calves than the buffalo calves. Theincrement in the immunoglobulin levels wassignificant (P<0.05) within 6 days of postcolostralfeeding; thereafter a consistency was maintained,except for the status of IgG, which was always keptat higher levels. Overall, five bands were recordedin PAGE out of which the 1st band was conspicuous.The other bands might have been fragmented partsof IgD and IgA. After feeding of the colostrum tothe calves, the molecular weight and density of the

bands increased, which is indicative of thepolymerization of the immunoglobulins.

The immunomodulators like neem oil andwithaneloid also enhanced the polymerization ofimmunoglobulins. The mechanism of action of theherbal immunomodulators is not clear, but these aresupposed to arrange the amino acids and possiblyactivate the production of specific mRNA fromDNA. The 6th band appeared in PAGE 15 days afterpostcolostral feeding along with consolidation of thebands in terms of density, which indicated theinfluence of immunomodulators. At this period oftime the IgA appears to have increased inconcentration with molecular weight around 80 KD.Subsequently, 30 days onwards, the consolidationof the bands was indicative of the furtherpolymerization of monomeric immunoglobulins, asmolecular weight as well as density of theimmunoglobulins were in increasing order. Theresults of increasing concentration of IgM with ageof the neonatal calves corroborate with thosereported by Ananthnarayan and Paniker (2003). Theeffect of neem oil and withaneloid on molecularweight and density of immunoglobulins was morepronounced as compared to Stenot. Finally, it wasevident from the results that the amount andmolecular weight of each immunoglobulin increasedwith consolidation by the 90th day of age of thecalves. The effect of immunomodulators particularly,the neem oil, was greater in cow calves than in thebuffalo calves insofar as increasing the levels ofserum immunoglobulins are concerned.

Thus, it can be surmised from theobservations made in this study that the buffalocalves from the very beginning not only had poorerimmuno-competence than the cow calves, but alsohad poor response to the immuno-boosters incomparison to the cow calves. Neem oil could berecommended as effective and cheap immune-booster for buffalo calves in order to reduce themortality rate.

87


Table 1. Place of procurement and number of the animals used in the experiment.

Table 2. Normal reported characteristics of various immunoglobulins.

88

S.No. Experimentation Animals Place of Procurement of

Animals

Number of

Animals

Cowcalves

LSF, Adhartal, COVS, Jabalpur and Military Dairy Farm, Barela, Jabalpur

6

1 Control Buffalo calves

LSF, Adhartal, COVS, Jabalpur and Reliable Dairy, Gwarighat, Jabalpur

6

Cowcalves LSF, Adhartal, COVS, Jabalpur 6

2 Treatment with Neem oil @ 10ml/day for three months, orally Buffalo

calves Reliable Dairy, Gwarighat, Jabalpur 6

Cowcalves

Military Dairy Farm, Barela, Jabalpur 6

3

Treatment with Withanolide @10ml/day in 1st week & subsequently at weekly interval for 90days, orally

Buffalo calves LSF, Adhartal, COVS, Jabalpur 6

Cowcalves

LSF, Adhartal, COVS, Jabalpur and Military Dairy Farm, Barela, Jabalpur

64

Treatment with Stenot @300mg/day in 1st week & subsequently at weekly interval for 90days, orally Buffalo

calves LSF, Adhartal, COVS, Jabalpur 6

Immunoglobulin IgM (Pantomeric form)

IgE , IgM (Monomeric form) IgA, IgG,IgD IgA

Molecular weight 900 (KD) 190-200 (KD) 180 -150 (KD) 100-70 (KD)


Table 3. Levels of IgM, IgG and IgA at different intervals in neonatal buffalo calves and cow calves as determined through ELISA.

M.W.-Molecular Weight Bc- Buffalo calves Cc- Cow calves

Table 4. PAGE of the sera samples of neonatal buffalo calves and cow calves before colostrum feeding.

*(P<0.05) Bc- Buffalo calves Cc- Cow calves

89

Time Interval Animals IgM(mg/ml)

IgG(mg/ml)

IgA (mg/ml)

Bc 0.262± 0.05 3.9±0.3* 1.9 ±0.3 Before Colostrums Feeding Cc 0.354±0.03 12.41±0.5 2.7±0.3

Bc 0.225 ± .07 5.99± 0.4* 2.0 ± 0.4* 6 h post colostral Feeding Cc 0.389±0.03 14.7± 0.5 5.2±0.52

Bc 0.205 ± .015 7.71± 0.3* 1.85 ± 0.1* 1st day Cc 0.36±0.02 15.00±1.1 7.9±0.7 Bc 0.345 ± .019 8.95±0.17* 2.9 ±0.21* 2nd day Cc 0.326±0.02 12.94±0.3 8.5±0.22 Bc 0.176 ±. 054* 8.62±0.44* 2.21 ± 0.26* 3rd day Cc 0.32±0.02 14.26±0.4 6.3±0.4 Bc 0.155±0.01* 7.59± 0.4* 1.95 ± 0.3* 4th day Cc 0.35±0.98 13.01±0.8 5.74±0.24 Bc 0.703±0.04* 8.30± 03* 1.43 ± 0.01* 5th day Cc 0.4±0.02 14.39±0.7 7.05±0.3 Bc 0.213±0.015 8.75± 03* 1.05 ± 0.1* 6th day Cc 0.37±0.014 13.53±0.5 2.03±0.3 Bc 0.216 ± 0.01 9.63± 0.4* 1.16 ± 0.1 14th day Cc 0.35±0.03 13.92±8.2 1.72±0.2 Bc 0.613 ±0253 9.32±0.05* 1.50 ± 0.13 28th day Cc 0.414±0.03 13.48±0.6 2.37±0.18 Bc 0.162 ± 0.06 10.28±0.13 1.31 ± 0.3 56th day Cc 0.39±0.022 13.8±1.2 3.2±0.2 Bc 0.364±0.017 7.98± 0.2 1.7± 0.3* 90th day postnatal Cc 0.35±0.07 8.6±0.4 6.01±0.4

Ani-mals

Treat-ment

1st Band IgM, IgE, IgG

2nd Band IgD, IgG

3rd Band IgD, IgA

4th Band IgA

5th Band IgA

M.W. (KD) Density M.W.

(KD) Density M.W. (KD) Density M.W

(KD) Density M.W. (KD) Density

Bc Control 165±.2 162071 109±.5 607381 71±.2 467164.5 58±.5 Consolidated

~3rd band 45±.2 904912

Cc Control 188±1 151047 133±.6 238935 78±.4 826697 62±.5 Consolidated ~3rd band 45±1 2863662


7 ot yad tsr if mo rf s evl ac

woc dna s ev lac o laffub l atanoen eh t fo selpma s are s eh t fo E

GAP .5 elbaT

ht.gn idee f

m urt solo c- tsop yad

se vla c wo

C - cC s e vl ac ol affu

B -cB th gi e

W r alu ce loM- .

W .M

90

inA

slam

fo epyT tne

mtaerT1

ts ,EgI ,

M gI d naB

GgI2

dn3

Gg I ,

DgI dn aB dr

4

Ag I ,DgI dnaB

h t5

AgI dnaB

ht

AgI dnaB

.W.

M )

DK(

ytisneD

.W.

M )

DK(

yt isneD

.W.

M )

DK (

ytis neD

.W .

M )

DK(

ytis neD

.W .

M )

DK(

ytisn eD

lor tn oC-71±681 3±40 2

-65 67 96 75 919

- 2± 941 41±1 51

-0 0624 7 8899 77 1

22±1 11 4±221

- 210027 detad ilosnoC

2~d n

d na b

- 1±48 31±68

d etadi lo sno C- dnab dr3~

4 30 59

±2±27 31 ±68

-4 66 957 3661 261

lio me e

N-2. 4± 112 5 ±31 2

-6 1 14 71 626 77 7

- 3± 741 1.± 061

- 3162 10 1 32 7321

-4±92 1 5. ±63 1

detad ilosnoC2 ~

dn-d nab

8978 01

-5 ±49 2 ±40 1

-852212 12 14431

- 2±7 6 2±3 8

- 43 649 923 458

ton etS-5 . 3± 012 1 ±51 2

-5. 1599 9 49 672 7

-3± 941 8.± 36 1

-5.3 478 6 05 78011

- 5. 2± 611 01± 1 31

-89 895 5.83669

-2±58 2± 70 1

- 01375 1 97 35 541

- 20.±77 1 .±1 9

-855 57 20 838 01

cB

edilona htiW

- 1± 712 7±3 62

-0256 01 333632 1

-2 ±441 6±002

24 1811 2939031

- 3± 13 1 5±851

de ta dilosnoC2~

dn-dnab

627441

-1 ±1 9 9.±011

-9109 91 0137371

- 3 ±5 6 2±87

-6 29 58 8 119911

lor tn oC-5±3 02 6±702

-79 80 41 4361182

-7±34 1 5.±051

-5 5421 3 2339674

-6.±911 11±731

-459954 deta dilosn oC

2~dn

dnab

-3.±48 8±48

111343 5. 088335

-6±66 3 ±6 7

432 125 5. 15165 6

lio mee

N-3±2 12 3±31 2

-79 80 41 73172 7

7±34 1 3±84 1

-832 2291 23396 74

-1±721 1 1±7 31

detadilosnoC2~

dn -dnab

.23936

8±48 4±69

11134 3 563927

-2±57 3±67

-86892 4 432 125

ton etS-6±2 02 3 ±22 2

708311 5.3 3205 6

- 9.±051 4±16 1

99 994 87 145 2

-3±521 8±7 31

73055 5 .8740 71

-1±09 2±111

5.618831 45466 01

-2±76 1± 58

82407 5.74 0416

cC

edil onah tiW

-2±122 91±742

5.77566 95 8172 1

-8.±941 01±28 1

46034 182 54 43

-1±721 31 ±531

d et adilo sn oC2 ~

dn-dnab

64979

-4±59 2 ±001

5.445731 53 53962

-5.±07 4 ±87

94169 9254 801


urtsoloc-tsop sy ad ytriht ot yad htn eetfi f morf se vlac

woc d na se vlac ola ffub latanoe n eh t fo selpma s are s eh t fo E

GAP .6 elba T

. gnide ef m

sevlac w o

C -cC s evl ac o laff u

B -cB th gie

W r al u cel oM- .

W .M

91

slamin

A f o epyT

tnem tae rT

1ts

dnaB

G gI , Eg I ,MgI

2d n

,DgI dn aB

GgI

3d r

dn aB

AgI ,Dg I

4h t

dnaB

AgI5

h t dnaB

AgI

6ht

dnaB

Ag I .

W.M

)D

K( y ti sn e

D .

W .M

)D

K( y t isne

D .

W .M

)D

K( y tis ne

D .

W .M

)D

K( y tisn e

D .

W.M

)D

K( yti sn e

D .

W .M

)D

K ( y tis ne

D

lortnoC-03±351 9± 681

7 1103 2 8 4730 4

-7± 46 1 1 ±37 1

-23 67 13788 23 31

8± 32 1 9±52 1

911 37 2 627 007

-8± 989±0 9

-95 3962 detadi losn oC

3~dr

dn ab

-8±868±7 6

- 027032 56354 21

oN

-dnaB 1 .± 43

dnaB oN

--

lio mee

N-44±182 3 ± 592

- 034 34 9 5181 9

-4± 161 1±46 1

-6678 6 3 82501

-6 ±33 1 4± 63 1

deta dilos no C2~

dn -dnab

24 56441

-2±878±39

-8 1048 663521

-7±2792±88

detadilosnoC4~

ht -dnab

187 711

-5. ±93 12±95

-817 00 61 6 36381

tone tS- 3±26 2 5± 972

-6 3466 1 0 0472 6

-6± 141 3±77 1

-6 36021 69 3815

-5±03 1 2± 44 1

-945 95 2 203131

1±578±09

-893871 5 .0 51525

-7± 8642±87

det adi losnoC4 ~

ht -d nab

8 16331

-2.±2 .53 3 2±8 5

-596 06 1 583189

cB

edi lonahtiW

- 3± 012 8±6 52

-594 97 000513

-5 .±071 2±302

-0 10 241 600225

-1± 341 5.±54 1

-8 29 55 1 323143

-3 ±8 85±89

-079201 122182

- 4± 3721±88

detad ilosn oC4 ~

ht d nab 8127712

-1.±63 21±35

-994351 53 06471

l ort no C-21±722 3± 462

-31669 8 1994 3

-1± 251 9±76 1

-1 ±142 180904

-8 ±52 1 2± 131

detadilosno C2~

dn d nab 0924901

-2±862±69

-389291 8 24 4691

-9±3642±96

- 734961 de ta dilosnoC

4 ~h t

d nab

oN

-dnaB 8 1±6 5

dnaB oN

lio mee

N - 9±20 3 61± 813

-4 6325 1 8 0208 7

-3± 261 6 ±981

-8 46545 6 09447

-2 .±931 9± 96 1

- 08 450 1 821269

-5± 98 2 ±40 1

-1 51645 18 965

-3± 6774± 97

- 817 231 25402

- 2.± 14 5 3±7 5

- 0560241 926381

tone tS-51 ±8 22 5 ±082

- 58449 3 0354 4

-4± 341 9±94 1

-5022 3 096477

-9±131 2± 831

-21 0601 7903151

-9± 182±78

detadilosnoC3~

dr -dnab

476421

-2±66 32±47

-94 049 6 38551

-3± 14 71±76

2 0632 1 2523452

cC

edilonaht iW

- 4±662 2± 582

-2 99 92 1 0 4340 5

-2 ±161 7±8 61

-41554 8752 21

-8 ±13 1 6± 33 1

-85107 1 185 476

-7± 784±6 9

-452 01 03919

-4±3 78±57

detadilosnoC4~

ht -dnab

7146 292

oN

-dnaB1± 07

oN

-dnaB 0 13611


nideef murtsol oc -tso p syad ytenin ot y txi s

m orf sevl ac wo c dna se vla c o la ffub lat ano en eh t fo selp

mas ares e ht f o EG

AP .7 elb aT.g

s evlac wo

C -cC

sevla c olaf fuB -c

Bth gi e

W raluc eloM - .

W .M

92

s lamin

A-onu

mmI

srot al ud om

1ts

dnaB

Gg I ,Eg I ,MgI

2dn

G gI ,

D gI d naB 3

dr dnaB

AgI ,D g I

4ht

dnaB AgI

5ht

dnaB Ag I

6h t

dnaB AgI

.W.

M

)D

K( ytisne

D .

W.M

)D

K ( yt isne

D .

W .M

)D

K( ytis ne

D .

W.M

)D

K( ytisn e

D .

W.M

)D

K( ytis ne

D .

W.M

)D

K( y tis ne

D

l ortn oC -4±86 2 4 1±8 72

- 18 657 6580 11

- 7± 571 5± 812

detadill os noC2~

dn - dnab

81 147

- 7±83 1 1± 27 1

dnaB oN

1 5175 - - 6.±69 3 ±901

-222 19 92 19 17

-2.±86 5 .±67

-6 8714 1 21 136

oN

-dn aB 85.± 73

oN

-d naB98 23 051

lio mee

N -41. ±5 23

2±733 -64 2921 1 4041 6

-1.±771 9±7 71

-7020 8 33 1284

-1 1±1 11 2.± 931

- 59624 509 47 1

- 5±28 5.±09

-71 739 011 197

-5 ±35 2.±36

- 160211 0454 21

-1 0.±53 20.± 04

-0200 15701 10 81

tonetS-1 ±8 22 2 ±49 2

- 89 479 59 219 2

- 2± 261 6 ±7 71

det adill osnoC2~

dn - dnab

22200 1

- 5± 55 6± 61 1

-5. 14477 7 0 78 8

- 60 .±38 1±721

-42 2301 2 76 62 1

-1 ±06 8.±78

-5.64831 1 722691

- 8.± 43 3 .± 73

-007 94 50 685162

cB

e dil onaht iW

-7 ±6 52 4 ±092

-1 3340 1 6 0360 1

- 8. ±27 1 5±4 91

deta dill osn o C2~

dn - dnab

17446 1

-7. ±2 4 1 4± 95 1

-5.1 76 48 d etadillosno C

4~ht

d na b

-6± 801 2±211

-5 .70509 315 29

-5±764 ±17

-5.63667- 965 40 1

-2. ±2 41 .1± 15

-185 05 1 45 39

l ort noC -2 ±971 0 1± 872

-41177 1 5408

-5 ±071 1±1 81

de tadillos noC2~

dn - dn ab

57418

-3 . ± 04 1 01±5 51

-dnaB oN

0 77 9-2±7 9 5± 401

-259 031 045247

- 2±962± 87

-384231 1202 51

oN

-dnaB 1.± 93

oN

- dnaB06232616106901

01 ±65 4809141

21±175 .8941 82

31±69 5. 517691

9±521 01575

4±3 61 5 .1 51073

61±033 lio

meeN

t one tS -2 ±3 92 9±952

- 20850 1 4 22021

-1±8 71 2±971

detadillosnoC2~

dn -dnab

61 7901

-5 ±131 4 1±7 41

-0 68 53 1 644068

-1±9 3 4±89

-3 58 611 313641

- 2±262±07

67172 1-5.414551

-1 .± 34 2.±15

- 35 924 5 77559

cC

edilo nahtiW

-31±222 1±18 2

-620521 5 .0946 9

-2±571 8±781

-94544 - 5.7 8949

-1.±341 6 ±15 1

-5.712531 detadillosno C

4~ht

dnab

-4±401 4±0 11

-398965.651621

-4±476± 28

-5.68868 5.552841

-2.±653±76

-63125 5 .3752 8


Figure 1. Electrophoregram of neonatal buffalo calves’ and cow calves’ serum immunoglobulins (days 1 to 7).


93



ACKNOWLEDGEMENTS

The authors gratefully acknowledge thefinancial help given by the ICAR, New Delhi underad-hoc project P-326.

REFERENCES

Ananthnarayan, R. and S.K.J. Paniker. 2003.Antibodies- Immunoglobulins. In Text Bookof Microbiology. Orient Longman Pvt., Ltd.,Hyderabad. 82-84.

Jain, A.K., I.J. Sharma, M.A. Quadri, R.K. Tripathi,R.G. Agrawal and A. Mishra. 2007.Comparativefeature of buffalo’s and cow’scolostrum vis-a-vis their sera samples. IndianJ. Dairy Sci., 60: 199-201.

Richard, A.G., J.K. Thomas and A.O. Barbara. 2000.Kuby Immunology, 4th ed. W.H. Freeman andCo., New York. 115-147.

Snedecor, G.W. and W.G. Cochran. 1994. StatisticalMethods, 7th ed. Oxford & IBH Pub. Co.,New Delhi. 312-317.

94


CYTOGENETIC STUDIES ON THE CHROMOSOMES OF TODA BUFFALOES

N. Murali*, P. Devendran and S. Panneerselvam

Department of Animal Genetics and Breeding, Veterinary College and Research Institute, Namakkal, TamilNadu, India, *E-mail: [email protected]

ABSTRACT

Karyological studies and sister chromatidexchange analysis were carried out in Todabuffaloes stationed at the Sheep Breeding ResearchStation, Sandynallah, Ooty, Tamil Nadu. Mitosis wasinduced by pokeweed mitogen in short termleucocyte cultures and bromodeoxyuridine wasincorporated in the cultures to elucidate the sisterchromatid exchanges. The modal chromosomenumber was found to be 50 (2n) as in other rivertype buffaloes, and the relative length ofchromosomes ranged between 7.12 + 0.01 and 2.51+ 0.34. The mean sister chromatid exchangefrequency was 7.8 + 0.23, and the data on SCEfrequency was found to follow the Poissondistribution.

Keywords: river buffalo, Toda buffalo,chromosomes, relative length, sister chromatidexchange

INTRODUCTION

The preference of buffaloes as milchanimals in India is increasing over the years as theyare considered to be a better converter of fibrousfeeds into milk, more resistant to diseases and betteradapted to local climatic conditions. Buffaloescontribute more than 54 percent to the total milkproduction in India. Buffalo cytogenetics could serveas an essential tool in implementation of breedingprogrammes, particularly in screening bulls used forartificial insemination programmes. Systematiccytogenetic investigation of breeding problems of

buffaloes is still lacking, and hence most of theaberrations have escaped our attention.

Toda buffaloes, named after an aboriginaltribe the Toda of South India, are a geneticallyisolated group of animals found in the Nilgiris districtof Tamil Nadu, India. This the only breed of buffalobeing reared in this high rainfall and high altituderegion has some phenotypic resemblance to theswamp buffaloes, but based on karyological studies,it is classified under the river buffalo (Nair et al.,1986).

This paper presents the karyotype, relativelength of the chromosomes and sister chromatidexchange (SCE) frequency of Toda buffaloes.


Blood samples were collected in vacutainerscontaining sodium heparin from seventeen male andthree female Toda buffaloes maintained at the SheepBreeding Research Station, Sandynallah, Ooty, TamilNadu, India. All the animals were apparently healthyand were above the age of 18 months. The cultureswere set up using RPMI 1640 culture medium andbuffy coat and autologous plasma from the bloodsamples. Mitosis was induced by the incorporationof pokeweed mitogen (10 μg/ml), and the cultureswere incubated at 37.5oC for 72 h. The cultureswere harvested with colchicine followed byhypotonic treatment (0.075 M KCl) and fixed inmethanol: acetic acid (3:1). Air-dried slides wereprepared and stained in 2 percent Giemsa (Kumarand Yadav, 1991). About 25 metaphase spreads werescreened for chromosome complement. Thosespreads with clear staining and non-overlappingchromosomes were photographed (x 1000) for the

95


preparation of karyotypes and measuring relativelength of the chromosomes.

Simultaneously, duplicate cultures wereincubated with the incorporation of thebromodeoxyuridine (BrdU: 10 μg/ml) at 20 h ofincubation and the samples were also harvested asper standard protocol (Iannuzzi et al., 1988). Air-dried slides were prepared, stained in Hoechst 33258(10 μg/ml) for 15 minutes, incubated in 2x SSC bufferat 60oC for 1 h, exposed to sunlight in the samebuffer and stained in 2 percent Giemsa (Perry andWolff, 1974). About 25 metaphase spreads withcomplete chromosome complement and appreciablesister chromatid differentiation were counted foreach animal to arrive at the mean SCE frequency.

RESULTS AND DISSCUSSION

The chromosomal complement revealed adiploid chromosome number (2n = 50) and themorphology resembles (first 5 pairs weresubmetacentric and the remaining 19 pairs wereacrocentric) that of the river buffaloes (Nair et al.,1986; Iannuzzi, 1994). The relative length ofchromosomes ranged between 6.74 + 0.04 and 2.02+ 0.00 (Table 1) and the ideogram is presented inFigure 1. The Y chromosome was one of the smallacrocentrics and not always identifiable whereas theX chromosome was the largest acrocentric and waseasily recognised in all metaphase spreads. Themetaphase spread with complete chromosomecomplement and the karyotype are presented inFigures 2 and 3 respectively.

The comparative relative length of thechromosomes (from the longest to shortest) ofMurrah, Surti and Mehsana were reported to rangefrom 6.73 + 0.28 to 2.24 + 0.19, 6.92 + 0.35 to 2.21+ 0.24 and 6.46 + 0.23 to 2.23 + 0.16 respectively(Kumar and Yadav, 1991). Gupta and Chaudhuri

(1978) reported the relative length of Indian Murrahbuffaloes to range between 7.42 + 0.08 and 1.69 +0.08 and Joshi and Govindaiah (1997) reported inSouth Kanara buffaloes of Karnataka as 6.8 + 0.17for the longest and 1.92 + 0.7 for the shortestchromosome and these reports are comparable tothe results obtained in the present study in Todabuffaloes.

The mean SCE frequency was estimatedas 7.8 + 0.23. The longer submetacentricchromosomes were observed to carry a greaternumber of exchanges when compared to theautosomal acrocentrics. The distribution of the SCEswas found to follow Poisson distribution. Themetaphase spreads with SCEs in chromosomes ofToda buffalo are presented in Figure 4.

The SCE test has been used to detect thegenome stability in most livestock species like cattle(Ciotola et al., 2005), sheep (Di Meo et al., 2000)and pigs (Peretti et al., 2006). However, studies inbuffaloes are comparatively few. The mean SCEfrequency in indigenous buffaloes was reported tobe 7.61 + 0.18 (Joshi et al., 1996) and 3.66 per cell(Vijh et al., 1991) in Murrah buffaloes, 5.56 per cell(Vijh et al., 1995) in Bhadawari buffaloes and 14.05+ 0.12 (Murali et al., 1998) in Surti buffaloes. Adetailed study of SCE in chromosome of riverbuffaloes reared in southern Italy revealed a meanSCE frequency of 8.8 + 3.4 (Iannuzzi et al., 1988).The base line SCE frequency in Beheri and Saidibreed of Egyptian water buffaloes was reported as8.3 + 1.1 and 7.76 + 0.8 respectively (Ahmed, 2001).The observations made in the present study and thedata on SCE in the literature suggest that the SCEsin the chromosomes of buffaloes have a wide rangeand hence the technique has to be standardised ineach laboratory so as to utilise it for assessing theeffect of external agents.

96


97

Chromosome Mean ± S.E.

1 6.74 ± 0.04 2 6.34 ± 0.04 3 6.17 ± 0.08 4 5.53 ± 0.02 5 4.45 ± 0.18 6 4.56 ± 0.01 7 4.35 ± 0.02 8 4.03 ± 0.05 9 3.86 ± 0.03 10 3.79 ± 0.01 11 3.74 ± 0.00 12 3.60 ± 0.02 13 3.56 ± 0.02 14 3.48 ± 0.02 15 3.30 ± 0.00 16 3.07 ± 0.01 17 2.88 ± 0.07 18 2.82 ± 0.08 19 2.78 ± 0.06 20 2.70 ± 0.02 21 2.54 ± 0.01 22 2.32 ± 0.08 23 2.18 ± 0.05 24 2.02 ± 0.00 X 6.40 ± 0.00 Y 2.79 ± 0.03

Table 1. Relative length (mean + s.e.) of chromosomes of Toda buffalo.


98


99

Figure 2. Metaphase spread (x 1000) of Toda buffalo (male).

Figure 3. Karyotype of male Toda buffalo.


100

REFERENCES

Ahmed, S. 2001. Sister chromatid exchanges inEgyptian water buffalo. Buffalo J., 1 : 129-136.

Ciotola, F., V. Peretti, and G.P. Di Meo. 2005. Sisterchromatid exchanges (SCEs) in the Agerolescattle population. Vet. Res. Commun., 29: 359-361.

Di Meo,G.P., A. Perucatti, and D. Fornataro. 2000.Sister chromatid exchange in chromosome ofsheep (Ovis aries). Cytobios, 101: 71-78.

Gupta, P. and S.P.R. Chaudhuri. 1978. Robertsonianchanges in the chromosomes of Indian Murrahbuffalo (Bubalus bubalis). The Nucleus, 21:90-97.

Iannuzzi, L. 1994. Standard karyotype of the riverbuffalo (Bubalus bubalis L., 2n=50). Reportof the committee for the standardisation ofbanded karyotypes of the river buffalo.Cytogenet Cell Genet., 67: 102-113.

Iannuzzi, L., A. Perucatti, G.P. Di Meo and L.Ferrara. 1988. Sister chromatid exchange inchromosomes of river buffalo (Bubalusbubalis L.). Caryologia, 41: 237-244.

Joshi, S.K. and M.G. Govindaiah. 1997. Karyologicalstudies in South Kanara buffaloes ofKarnataka. Indian Vet. J., 74: 1037-1039.

Joshi, S.K., M.G. Govindaiah and M.R. Jayashankar.1996. Sister chromatid exchanges (SCEs) inMurrah buffaloes. Indian J. Dairy Sci., 49:156-159.

Kumar, P. and B.R. Yadav. 1991. Comparativecytogenetic studies in Mehasana, Murrah andSurti buffaloes. Indian J. Dairy Sci., 44: 2.

Murali, N., V. Thiagarajan and A.M. Nainar. 1998.Effect of industrial pollution on sister chromatidexchanges frequency in buffaloes. Indian J.Anim. Sci., 68: 659-661.

Nair, P.G., M. Balakrishnan and B.R. Yadav. 1986.The Toda buffaloes of Nilgiris. Buffalo J., 2:167-178.

Peretti, V., F. Ciotola, C. Dario, S. Albarella, G.P. DiMeo, A. Perucatti, V. Barbieri and L. Iannuzzi.2006. Sister chromatid exchange (SCE) forthe first time in Casertana pig breed.Hereditas, 143: 113-116.

Perry, P. and S. Wolff. 1974. New Giemsa methodfor the differential staining of sisterchromatids. Nature, Lond., 251: 156-158.

Vijh, R.K., R. Sahai and A. Sharma. 1991. Sisterchromatid exchanges in Murrah buffaloes.Indian J. Anim. Sci., 61: 991-993.

Vijh, R.K., R.K. Pundir and R. Sahai. 1995. Baseline SCE frequency in Bhadawari buffaloes(Bubalus bubalis). Indian J. Dairy Sci., 48:660-663.

Figure 4. Sister chromatid exchange (SCE) in chromosomes of Toda buffalo (x 1000).


ISOLATION, CULTURE AND CHARACTERIZATION OF ENDOMETRIAL EPITHELIAL CELLSIN BUFFALO (BUBALUS BUBALIS)

S. Mondal*, S. Nandi, I.J. Reddy and K.P. Suresh

National Institute of Animal Nutrition and Physiology Adugodi, Bangalore - 560 030, India, *E-mail:[email protected]

ABSTRACT

In the present study, the authors isolated anddeveloped the culture of endometrial epithelial cellsfrom buffalo uterus as well as evaluated functionalproperties of epithelial cells. In primary culture,epithelial cells appeared cuboidal or columnar andshowed contact inhibition at the stage of confluence.Protein and DNA concentrations were found toincrease with the time in culture. PGF2αconcentrations declined from 7.25±2.02 pg/μg DNAon Day 3 of culture to 6.33±1.80 pg/μg DNA onDay 5 of culture and thereafter to 2.98±1.09 pg/μgDNA on Day 7 of culture in endometrial epithelialcells. It was concluded that buffalo endometrialepithelial cells could serve as an excellent model forstudying the specific role of PGF2α in maternalrecognition of pregnancy and implantation.

Keywords: epithelial, PGF2α, buffalo

INTRODUCTION

Early embryonic mortality is the main sourceof reproductive wastages in domestic ruminantsincluding buffalo. The interaction between theembryo and the maternal unit is a prerequisite tomaternal recognition of pregnancy, implantation andparturition (Thatcher et al., 1985). During earlypregnancy, the growing embryo solely depends onuterine microenvironment for survival and growthas the uterine environment undergoes continualmodifications to cope the needs of the embryo. Ifthe embryo fails to signal its presence during thisperiod (days 12-18 of pregnancy), because of lackof synchrony between uterine environment and the

embryo, premature expulsion of embryo occurs. Inruminants, endometrial production of prostaglandins(PGs) plays important roles in ovulation, luteolysis,implantaion, decidualization and parturition (Poyser,1995; Dubois et al., 1998). The endometrial epithelialand stromal cells have specific morphological andfunctional properties. Epithelial cells preferentiallyproduce PGF2α whereas stromal cells producemainly PGE2 (Fortier et al., 1988; Asselin et al.,1997). PGF2α acts as the luteolytic agent (Bazer etal., 1994) to control the estrous cycle in ruminants.In contrast, PGE2 protects the corpus luteum (CL)from the spontaneous regression (Magness et al.,1981) and helps in the maintenance of pregnancy. Itenhances endometrial vascular permeability at thesites of blastocyst apposition and decidualization(Kennedy and Lukash, 1982; Keys and Kennedy,1990). PGE2 also plays a major role in blastocysthatching (Baskar et al., 1981) and implantation(Holmes and Gordashko, 1980). Recently, in vivoand in vitro studies have evaluated the regulationof PG production, interactions between immune andendocrine factors in the bovine uterus andinteractions between embryo and endometrium. Inspite of having many advantages, in vivo studiesare not suitable for examining some aspects ofautocrine and/or paracrine mechanism in uterus. Amajor drawback of the in vivo situation is that localeffects at the site of interaction may be masked bythe anatomical complexity of the genital tract.Therefore, to study the local mechanism involved inPG synthesis, luteolysis and maternal recognition ofpregnancy, it is essential to isolate and cultureendometrial epithelial cells.

Although both kinds of endometrial cells canproduce PGF2α, they have different morphologicaland physiological properties (Fortier et al., 1988;

101


102

Asselin et al., 1997; Skarzynski et al., 2000).Therefore, to investigate the functions of endometrialcells, it is essential to isolate a pure population ofepithelial cells. However, it is difficult to separate apopulation of endometrial cells of one type that isnot contaminated with endometrial cells of anothertype or with other cells present in buffalo uterussuch as fibroblasts or vascular endothelial cells. Theobjective of the present study was to evaluate themorphological and functional characteristics ofprimary culture of epithelial cells isolated frombuffalo uterus.


Isolation of endometrial epithelial cellsBuffalo uteri were collected from the local

abattoir immediately after slaughter and transportedto the laboratory on ice. Based on colour,vasculature, size and consistency of corpus luteum(Arosh et al., 2002; Verma-Kumar et al., 2004), thestages of estrous cycle were classified. Uteri of midestrous cycle (Days 5-10 of the cycle) were used inthis study. The epithelial cells from the buffaloendometrium were separated by the method ofSkarynski et al. (2000) with slight modification.Briefly, the uterine lumen was washed three timeswith sterile Ca2+and Mg2++ free Hank’s BalancedSalt Solution (HBSS) supplemented with 100 IU/mlgentamycin and 0.1 % BSA. The ends of the uterinehorn ipsilateral to corpus luteum were tied in orderto retain the trypsin solution for solubilizing theepithelial cells. Fifteen to twenty milliliters of sterileHBSS containing 0.3 % trypsin was then infusedinto the uterine lumen. Epithelial cells were isolatedby incubation at 37 oC for 60 minutes. The cellsuspension obtained from the digestion was filteredthrough a plastic strainer (70 μM) to removeundissociated tissue fragments. The filtrate waswashed 3 times with HBBS supplemented withgentamycin and 0.1 % BSA by centrifugation at600x g for 10 minutes. The number of viable cellsthat excluded Trypan blue was counted using ahaemocytometer.

Culture of endometrial epithelial cellsAfter cell counting and viability determination,

the epithelial cells were seeded at the rate of 1x105

viable cells in RPMI 1640 medium at 38.5oC inpresence of 5 % CO2 for 7 days. The viability ofepithelial cells at the time of plating was greater than90 %. The medium was changed every 2-3 daysuntil the confluency was reached.

Recovery of cells, proteins and DNAmeasurements

Cells were harvested on Day 3, Day 5 andDay 7 of culture after washing three times withDPBS and centrifugation at 500xg for 15 minutes.Growth was estimated by measuring the levels ofprotein with folin-phenol reagent (Lowry et al.,1951) and of DNA by the diphenylamine method(Burton et al., 1956) in the cell pellet.

Determination of PGF2αααααThe concentrations of PGF2α were

determined in 50 μl aliquots of culture medium after10 fold dilution with extraction buffer using ELISAkits supplied by Neogen, USA. The sensitivity ofthe assay was 0.002 ng/ml. The cross reactivity ofthe antisera against 6-keto prostaglandin F1α, 13, 14dihydro-15 keto-prostaglandin F2α, prostaglandin D2and prostaglandin E2 were 3.05 %, 0.05 %, 0.05 %and <0.01 %, respectively. The intra- and inter-assaycoefficients of variation were less than 15 %. Datawere analyzed for descriptive statistics andsignificance has been obtained by using the RepeatedMeasures Analysis of Variance (SPSS 16.0).


After trypsin dispersion, the epithelial cellswere released as single cells or clumps of differentsizes (Figure 1). These cells began to attach to culturedishes within 24-48 h after seeding and reachedconfluence after 6 to 7 day in culture. In primaryculture, epithelial cells exhibited cuboidal or columnarmorphologies (Figure 2) and showed contactinhibition at the stage of confluence (Figure 3). Thepatterns of cellular growth were evaluated byproteins and DNA profiling (Table 1). Protein


concentrations have been found to increase with thetime in culture. Similarly, DNA concentrationsincreased progressively from Day 3 to Day 5 andthen to Day 7 of culture. PGF2α concentrationsdecreased from 7.25±2.02 pg/μg DNA (n=6) on Day3 of culture to 6.33±1.80 pg/μg DNA (P=0.778; n=6)on Day 5 of culture and thereafter to 2.98±1.09 pg/μg DNA (P=0.039; n=6) on Day 7 of culture.

To the best of our knowledge, this is thefirst study to report the isolation, culture andcharacterization of endometrial epithelial cells inbuffalo. Epithelial cells from uterine endometriumhave been separated and cultured for several speciesincluding human (Liu and Tseng, 1979), rat(McCormack and Glasser, 1980), rabbit(Gerschenson et al., 1981, Fortier et al., 1987),cattle (Fortier et al., 1988) but not buffalo. In thisstudy, we report the separation and culture ofepithelial cells from buffalo endometrium usingmodifications of method previously described forcattle (Skarynski et al., 2000). Endometrial epithelialcells in buffalo were cuboidal or columnarmorphologies, which agrees with the earlier reportby Fortier et al. (1988) in cattle. The pattern ofprotein and DNA in buffalo endometrial culture

confirms the results of Fortier et al. (1988) in termsof increase in protein and DNA content with thetime in culture in cattle. The characterization of thesecells using immune-histochemistry, electronmicroscopy or antibody labeling is not available inthis species. The function of endometrial epithelialcells is important in order to explore the basicinformation of implantation and pregnancy.However, the tissues may act alone or in concertand through their specific prostaglandin syntheticcapabilities on vascular permeability (Kennedy,1980; 1985) and blood flow (Ford et al., 1979), whichare altered before implantation or at the time ofmaternal recognition of pregnancy. Similarly, theinvolvement of epithelial cells of the endometriumwith the luteolytic process during maternalrecognition of pregnancy needs to be characterizedin buffalo.

In conclusion, we have developed isolationand culture of buffalo endometrial epithelial cells thatmaintain their morphological characteristics andsecrete PGF2α. This system can be used for studyingthe specific role of PGF2α in maternal recognition ofpregnancy and implantation.

Figure 1. Photomicrograph of endometrial epithelial cells 36 h after plating, magnification X 10.

103


104

Figure 3. Endometrial epithelial cells at the stage of confluence on Day 7 of culture, magnification X 10.

Figure 2. Endometrial epithelial cells on Day 5 of culture, magnification X 40.


Table 1. Growth pattern of endometrial epithelial cells in culture.

Non-identical superscripts are significant at 5 % level of significance.

ACKNOWLEDGEMENTS

We thank the director, NIANP, for providingthe necessary facilities to carry out the researchwork. The help rendered by S. Selvakumar isgratefully acknowledged.

REFERENCES

Arosh, J.A., J. Parent, P. Chapdelaine, J. Sirois andM.A. Fortier. 2002. Expression ofcyclooxygenases 1 and 2 and prostaglandin Esynthase in bovine endometrial tissue duringthe estrous cycle. Biol. Reprod., 67: 161-169.

Asselin, E., P. Drolet and M.A. Fortier. 1997.Cellular mechanisms involved during oxytocin-induced prostaglandin F2α production inendometrial epithelial cells in vitro: role ofcyclooxygenase-2. Endocrinology, 138:4798-4805.

Bazer, F.W., T.L. Ott and T.E. Spencer. 1994.Pregnancy recognition in ruminants, pigs andhorses: signals from the trophoblast.Theriogenology, 41: 79-94.

Baskar, J.F., D.F. Torchiana, J.D. Biggers, E.J.Corey, N.H. Anderson and N. Subramanian.1981. Inhibition of hatching of mouseblastocyst in vitro by various prostaglandinantagonists. J. Reprod. Fertil., 63: 359-363.

Burton, K. 1956. A study of the conditions andmechanisms of diphenylamine reaction for thecolorimetric estimation of DNA. Biochem. J.,62: 315-322.

Dubois, R.N., S.B. Abramson, L. Crofford, R.A.Gupta, L.S. Simon, L.B. Van De Putte andP.E. Lipsky. 1998. Cyclooxygenase in biologyand disease. FASEB J., 12: 1063- 1073.

Ford, S.P., J.R. Chenault and S.E. Eckternkamp.1979. Uterine blood flow of cows duringoestrous cycle and early pregnancy: effect ofthe conceptus on the uterine blood supply. J.Reprod. Fertil., 56: 53-62.

Fortier, M.A., M. Boulanger, A.P. Boulet and R.D.Lambert. 1987. Cell specific localization ofprostaglandin E2 sensitive adenylate cyclasein rabbit endometrium. Biol. Reprod., 36:1025-1033.

Fortier, M.A., L.A. Guilbault and F. Grasso. 1988.Specific properties of epithelial and stromalcells from the endometrium of cows. J.Reprod. Fertil., 83: 239-248.

Gerschenson, L.E., J.R. Depaoli and J.T. Murai.1981. Inhibition of estrogen inducedproliferation of cultured rabbit uterine epithelialcells by a density-dependent factor producedby the same cells. J. Steroid Biochem., 14:959-969.

Holmes, P.V. and B.J. Gordashko. 1980. Eviendceof prostaglandin involvement in blastocystimplantation. J. Embryo. ExperimentalMorphol., 55: 109-122.

Kennedy, T.G. 1980. Prostaglandins and theendometrial vascular permeability changespreceding blastocyst implantation anddecidualization. Prog. Reprod. Biol., 2: 234-243.

Kennedy, T.G. 1985. Evidence for the involvementof prostaglandins throughout the decidual cell

105

Day of culture Protein(μg/25 μl)

DNA(μg/25 μl)

Day 3 6.55±1.54a 10.63±1.02a

Day 5 21.30±0.89ab 13.87±0.55b

Day 7 41.13±0.59bc 16.28±1.46c

Significance F = 6.882; P = 0.013 F = 211.819; P < 0.001


reaction in the rat. Biol. Reprod., 33: 140-146.

Kennedy, T.G. and L.A. Lukash. 1982. Induction ofdecidualization in rats by the intrauterineinfusion of prostaglandins. Biol. Reprod., 27:253-260.

Keys, J.L. and T.G. Kennedy. 1990. Effect ofindomethacin and prostaglandin-E2 onstructural differentiation of rat endometriumduring artificially induced decidualization.American J. Anat., 188: 148-162.

Liu, H.C. and L. Tseng. 1979. Estradiol metabolismin isolated human endometrial epithelial glandsand stromal cells. Endocrinol., 104: 1674-1681.

Lowry, O.H., N.J. Rosebrough, A.L. Farr and R.J.Randall. 1951. Protein measurement with thefolin phenol reagent. J. Biol. Chem., 193: 265-275.

Magness, R.R., J.M. Huie, G.L. Hoyer, T.P.Huecksteadt, L.P. Reynolds, G.J. Seperich, G.Whysong, and C.W. Weems. 1981. Effect ofchronic ipsilateral or contralateral intrauterineinfusion of prostaglandin E2 (PGE2) on lutealfunction of unilaterally overiectomized ewes.Prost. Med., 6: 389-401.

McCormack, S.A. and S.R. Glasser. 1980.Differential response of individual cell typesfrom immature rats treated with estradiol.Endocrinol., 106: 1634-1649.

Poyser, N.L. 1995. The control of prostaglandinproduction by the endometrium in relation toluteolysis and menstruation. Pros. Leuko.Essen. Fatty Acids, 53: 147-195.

Skarzynski, D.J., Y. Miyamoto and K. Okuda. 2000.Production of prostaglandin F2α by culturedbovine endometrial cells in response to tumornecrosis factor alpha : cell type specificity andintracellular mechanisms. Biol Reprod., 62:1116-1120.

Thatcher, W.W., J.J. Knickerbocker, F.F. Bartol,F.W. Bazer, R.M. Roberts and M. Drost. 1985.Maternal recognition of pregnancy in relationto the survival of transferred embryos:endocrine aspects. Theriogenol., 23: 129-143.

Verma Kumar, S., S.V. Srinivas, P. Muraly, V.K.Yadav and R. Medhamurthy. 2004. Cloningof a buffalo (Bubalus bubalis) prostaglandinF2α receptor: changes in its expression andconcentration in the buffalo corpus luteum.Reprod., 127: 705-715.

106

Instructions for Authors

Buffalo Bulletin is published by International BuffaloInformation Center under the authorization of Office of UniversityLibrary, Kasetsart University, Thailand. Contributions on any aspectof research or development, progress report of projects and news onbuffalo will be considered for publication in the bulletin.

General editorial policies

Authorship criteriaAuthorship is restricted to those who (1) have contributed

substantially to one or more of the following aspects of the work and (2)are willing to assume public responsibility for the validity of thework.Copyright

Copyright to published manuscripts becomes the soleproperty of International Buffalo Information Center.

Criteria for manuscript acceptanceManuscript acceptability is based on clarity of objectives;

originality; appropriateness of the experimental design, methods andstatistical analysis; substance of the results; thoroughness with which theresults are discussed; and appropriateness of the conclusions.

Following acceptance of a paper and prior to publication, theauthor will be received the acceptance letter.

Manuscript requirements

Manuscripts preparationManuscripts on original research in English language should

include at least the following elements.Title

• Full title (be concise)• Name(s) of author(s) and the first author

affiliation with complete address.Abstract

• An abstract not exceeding 250 words; allacronyms and abbreviations defined; noreferences cited. State what, where and how itwas done, major results.

• Five key words.Introduction. Review pertinent work, cite key references,explain importance of the research, and state objectives ofyour work.

Materials and Methods. Provide sufficient detail so workcan be repeated. Describe new methods in detail; acceptedmethods briefly with references.

Use of trade names. Trade names are to beavoided in defining products whenever possible.

Use of abbreviations and acronyms. At first textuse, define in parentheses. Do not use abbreviations andacronyms in titles.Results and discussion. Present results concisely usingfigures and tables as needed. Do not present the sameinformation in figures and tables. Discuss principles andrelationship, point out exception. Show agreement withpublished research work. The significances of work orconductions should be presented in the end of discussion.Tables. Number each table with Arabic numerals. Place adescriptive caption at the top of each table.

Figures. (graphs, charts, line drawings, photographs)Number each figure with Arabic numerals under theillustration. Lettering, data lines and symbols must besufficiently large so as to be clearly visible when the figureis reduced to a size commonly used in the journal.References. List only those references cited in the text.Required format of described below.

Reference cited format

Manuscripts should follow the name-year reference format.Cite only necessary publications. Primary rather than secondaryreferences should be cited, when possible. It is acceptable to cite workthat is “in press” (i.e., accepted but not yet published) with the pertinentyear and volume number of the reference.

In text. Cite publications in text with author name andyear. Three or more authors use “et al.”. In parenthetical citations,separate author and year with a comma. Use suffixes a, b and c toseparate publications in same year by the same author. Semi-colonseparate citations of different authors. Cite two or more publicationsof different authors in chronological sequence, from earliest to latest.For example:….used liquid nitrogen vapour freezing technique from Verma et al.(1975)….liquid nitrogen vapour freezing technique (Verma et al., 1975)…and buffaloes (Singh et al., 1983; Shah et al., 1987; Misra, 1996;Pant et al., 2002)In reference cited. List only those literature cited in the text.References should be listed alphabetically by the first author’s lastname. Single author precedes same author with co-authors. Typereferences flush left as separate paragraphs. Do not indent manually.Write the name of book or journal in italic letters. Use the followingformat.• Journal articles: Author(s). Year. Article title. Journal title,

volume number: inclusive pages.Example: Citation in text: Chaudhary et al. (1981)

Choudhary, P.C., B. Prasad and S.K. Misra. 1981. Note on the use of rumen liquor in the treatment of chronic alkaline indigestion in cows. Indian J. Anim. Sci., 51: 356-360.

• Books: Author(s) or editor(s). Year. Title. Publishername,Placeof publication. Number of pages.Example: Citation in text: Snedecor and Cochram. (1980)Snedecor, G.W. and W.G. Cochram. 1980. Statistical Methods, 7th ed.

The Iowa State University Press, Ames, Iowa, USA. 593p.Sattar, A. 1995. Studies on the effect of immunopotentiation of vaccinated pregnant buffaloes and cows on neonatal antibody titre and hematological profile. Ph. D. thesis, University of Agriculture, Faisalabad, Pakistan. 208p.• Chapter: Author(s) of the chapter. Year. Title of the chapter,pages of the chapter. In author(s) or editor(s). Title of the book.Publisher name, Place of publication.Example: Citation in text: Sloss and Dufty. (1980)Sloss, V. and J.H. Dufty. 1980. Disorders during pregnancy, p. 88-97. In Sloss, V. and J.H. Dufty (eds.) Handbook of Bovine Obstetrics. Williams and Wilkins, Baltimore, U.S.A.Sabrani, M., K. Diwyanto and M. Winugroho 1994. A critical review of buffalo research and development activities in

Indonesia. Past performanceand future strategies, p. 78-89. InProceedings of 1st Asian Buffalo Association Congress,Thailand.

Submission manuscriptSubmit the following items.Cover letter. Identify the corresponding author and provide his/herfull name, address, numbers for telephone and fax, and e-mail address.Manuscript. In 12 point Times or Times New Roman. Type on oneside of A4 paper. Use one inch margins. Number all pages. Send anoriginal manuscript and 1 photocopy.Disk. Include an IBM-formatted, 3-1/2" disk or 4-3/4" CD-ROM,containing the manuscript in Microsoft Word.Mail manuscript to:By post: International Buffalo Information Center

Office of University LibraryKasetsart University,50 Pahonyothin Road, Chatuchak,Bangkok 10900, ThailandTel. 66-2-942-8616

By e-mail: [email protected]


CONTENTSPage

BUFFALO BULLETINIBIC, KASETSART UNIVERSITY, P.O. BOX 1084

BANGKOK 10903, THAILAND URL : http://ibic.lib.ku.ac.th E-mail : [email protected] Tel : 66-2-9428616 ext. 344 Fax : 66-2-9406688

Induction of estrus in true anestrus buffaloes using crestar implants aloneand in combination with PMSG.Vivek Nayak, R.G. Agrawal, O.P.Srivastav and M.S. Thakur...........................................51

Re-utilization of crestar implants for induction of fertile estrus in true anestrus buffaloes.Vivek Nayak , R.G. Agrawal, O.P.Srivastav and I. J. Sharma.........................................55

Dystocia due to fetal maldisposition in a buffalo.G.K. Das, Ravi Dutt, Ravinder Kumar, S. Deori and Uma Shanker..................................59

Effect of piroxicam on the cellular response in buffalo calf skin.Neelu Gupta, A.K. Katiyar and Madhu Swamy................................................................61

Ultrasonographic biometry of the ovary and its responsesduring superovulation in Toda buffaloes.D.V. Patel, R. Anil Kumar, M. Iyue and R. Kasiraj...........................................................67

Seroprevalence of Brucella spp. in buffaloes in the central Gujarat region of India.M.N. Brahmabhatt, R.N. Varasada, C.D. Bhong and J.B. Nayak.....................................73

PDetection of bovine herpesvirus 1 (bhv-1) infection in semen of Indian breeding bullsby polymerase chain reaction and its characterization by DNA sequencing.Jain Lata, A.N. Kanani, J.H. Purohit, C.G. Joshi, D.N. Rank,Vinay Kumar and V.K. Jain..............................................................................................76

Quantitation of serum immunoglobulins of neonatal buffalo calves and cow calvesthrough ELISA and page: Status of immune-competence.Barmaiya, S., Aditi Dixit1, A. Mishra, A.K. Jain, A. Gupta, A. Paul,M.A. Quadri, A.K. Madan and I.J. Sharma.....................................................................85

Cytogenetic studies on the chromosomes of Toda buffaloes.N. Murali, P. Devendran and S. Panneerselvam..............................................................95

Isolation, culture and characterization of endometrial epithelial cellsin buffalo (Bubalus bubalis).S. Mondal, S. Nandi, I.J. Reddy and K.P. Suresh..........................................................101

2009-2buffalo bullrtin

Documents