15. strings
DESCRIPTION
15. Strings. Operations Subscripting Concatenation Search Numeric-String Conversions Built-Ins: int2str,num2str, str2double. Previous Dealings. N = input(‘ Enter Degree: ’) title(‘ The Sine Function ’) disp( sprintf(‘N = %2d’,N) ). - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/1.jpg)
Insight Through Computing
15. Strings
OperationsSubscriptingConcatenationSearchNumeric-String Conversions
Built-Ins: int2str,num2str, str2double
![Page 2: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/2.jpg)
Insight Through Computing
Previous Dealings
N = input(‘Enter Degree: ’)
title(‘The Sine Function’)
disp( sprintf(‘N = %2d’,N) )
![Page 3: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/3.jpg)
Insight Through Computing
A String is an Array of Characters
‘Aa7*>@ x!’
A a 7 * > @ x !
This string has length 9.
![Page 4: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/4.jpg)
Insight Through Computing
Why are Stirngs Important?
1. Numerical Data often encoded as strings
2. Genomic calculation/search
![Page 5: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/5.jpg)
Insight Through Computing
Numerical Data is Often Encoded in Strings
For example, a file containingIthaca weather data begins with the string
W07629N4226
Longitude: 76o 29’ WestLatitude: 42o 26’ North
![Page 6: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/6.jpg)
Insight Through Computing
What We Would Like to Do
W07629N4226
Get hold of the substring ‘07629’
Convert it to floating format so thatit can be involved in numerical
calculations.
![Page 7: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/7.jpg)
Insight Through Computing
Format Issues
9 as an IEEE floating point number:
9 as a character:
0100000blablahblah01001111000100010010
01000otherblablaDifferent Representation
![Page 8: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/8.jpg)
Insight Through Computing
Genomic Computations
Looking for patterns in a DNA sequence:
‘ATTCTGACCTCGATC’ACCT
![Page 9: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/9.jpg)
Insight Through Computing
Genomic Computations
Quantifying Differences:
ATTCTGACCTCGATCATTGCTGACCTCGAT
Remove?
![Page 10: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/10.jpg)
Insight Through Computing
Working With Strings
![Page 11: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/11.jpg)
Insight Through Computing
Strings Can Be Assignedto Variables
S = ‘N = 2’
N = 2;
S = sprintf(‘N = %1d’,N)
‘N = 2’
S
sprintf produces a formatted string using fprintf rules
![Page 12: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/12.jpg)
Insight Through Computing
Strings Have a Length
s = ‘abc’;
n = length(s); % n = 3
s = ‘’; % the empty string
n = length(s) % n = 0
s = ‘ ‘; % single blank
n = length(s) % n = 1
![Page 13: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/13.jpg)
Insight Through Computing
Concatenation
This: S = ‘abc’;
T = ‘xy’
R = [S T]
is the same as this: R = ‘abcxy’
![Page 14: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/14.jpg)
Insight Through Computing
Repeated Concatenation
This: s = ‘’;
for k=1:5
s = [s ‘z’];
end
is the same as this:
z = ‘zzzzz’
![Page 15: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/15.jpg)
Insight Through Computing
Replacing and AppendingCharacters
s = ‘abc’;s(2) = ‘x’ % s = ‘axc’
t = ‘abc’t(4) = ‘d’ % t = ‘abcd’
v = ‘’v(5) = ‘x’ % v = ‘ x’
![Page 16: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/16.jpg)
Insight Through Computing
Extracting Substrings
s = ‘abcdef’;
x = s(3) % x = ‘c’
x = s(2:4) % x = ‘bcd’
x = s(length(s)) % x = ‘f’
![Page 17: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/17.jpg)
Insight Through Computing
Colon Notation
s( : )
Starting Location
Ending Location
![Page 18: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/18.jpg)
Insight Through Computing
Replacing Substrings
s = ‘abcde’;
s(2:4) = ‘xyz’ % s = ‘axyze’
s = ‘abcde’
s(2:4) = ‘wxyz’ % Error
![Page 19: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/19.jpg)
Insight Through Computing
Question Time
s = ‘abcde’;
for k=1:3
s = [ s(4:5) s(1:3)];
end
What is the final value of s ?
A abcde B. bcdea C. eabcd D. deabc
![Page 20: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/20.jpg)
Insight Through Computing
Problem: DNA Strand
x is a string made up of the characters‘A’, ‘C’, ‘T’, and ‘G’.
Construct a string Y obtained from x by replacinig each A by T, each T by A, each C by G, and each G by C
x: ACGTTGCAGTTCCATATGy: TGCAACGTCAAGGTATAC
![Page 21: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/21.jpg)
Insight Through Computing
function y = Strand(x)
% x is a string consisting of
% the characters A, C, T, and G.
% y is a string obtained by
% replacing A by T, T by A,
% C by G and G by C.
![Page 22: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/22.jpg)
Insight Through Computing
Comparing Strings
Built-in function strcmp
strcmp(s1,s2) is true if the strings s1 and s2 are identical.
![Page 23: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/23.jpg)
Insight Through Computing
How y is Built Up
x: ACGTTGCAGTTCCATATGy: TGCAACGTCAAGGTATAC
Start: y: ‘’ After 1 pass: y: TAfter 2 passes: y: TGAfter 3 passes: y: TGC
![Page 24: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/24.jpg)
Insight Through Computing
for k=1:length(x)
if strcmp(x(k),'A')
y = [y 'T'];
elseif strcmp(x(k),'T')
y = [y 'A'];
elseif strcmp(x(k),'C')
y = [y 'G'];
else
y = [y 'C'];
end
end
![Page 25: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/25.jpg)
Insight Through Computing
A DNA Search Problem
Suppose S and T are strings, e.g.,
S: ‘ACCT’
T: ‘ATGACCTGA’
We’d like to know if S is a substring of T and if so, where is the first occurrance?
![Page 26: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/26.jpg)
Insight Through Computing
function k = FindCopy(S,T)
% S and T are strings.
% If S is not a substring of T,
% then k=0.
% Otherwise, k is the smallest
% integer so that S is identical
% to T(k:k+length(S)-1).
![Page 27: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/27.jpg)
Insight Through Computing
A DNA Search Problem
S: ‘ACCT’
T: ‘ATGACCTGA’
strcmp(S,T(1:4)) False
![Page 28: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/28.jpg)
Insight Through Computing
A DNA Search Problem
S: ‘ACCT’
T: ‘ATGACCTGA’
strcmp(S,T(2:5)) False
![Page 29: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/29.jpg)
Insight Through Computing
A DNA Search Problem
S: ‘ACCT’
T: ‘ATGACCTGA’
strcmp(S,T(3:6)) False
![Page 30: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/30.jpg)
Insight Through Computing
A DNA Search Problem
S: ‘ACCT’
T: ‘ATGACCTGA’
strcmp(S,T(4:7))) True
![Page 31: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/31.jpg)
Insight Through Computing
Pseudocode
First = 1; Last = length(S);
while S is not identical to T(First:Last) First = First + 1;
Last = Last + 1;
end
![Page 32: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/32.jpg)
Insight Through Computing
Subscript Error
S: ‘ACCT’
T: ‘ATGACTGA’
strcmp(S,T(6:9))
There’s a problem if S is not a substring of T.
![Page 33: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/33.jpg)
Insight Through Computing
Pseudocode
First = 1; Last = length(s);
while Last<=length(T) && ... ~strcmp(S,T(First:Last))
First = First + 1;
Last = Last + 1;
end
![Page 34: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/34.jpg)
Insight Through Computing
Post-Loop Processing
Loop ends when this is false:
Last<=length(T) && ...
~strcmp(S,T(First:Last))
![Page 35: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/35.jpg)
Insight Through Computing
Post-Loop Processing
if Last>length(T) % No Match found k=0;else % There was a match k=First;end
The loop ends for one of two reasons.
![Page 36: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/36.jpg)
Insight Through Computing
Numeric/StringConversion
![Page 37: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/37.jpg)
Insight Through Computing
String-to-Numeric Conversion
An example…
Convention: W07629N4226
Longitude: 76o 29’ West Latitude: 42o 26’ North
![Page 38: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/38.jpg)
Insight Through Computing
String-to-Numeric Conversion
S = ‘W07629N4226’
s1 = s(2:4);
x1 = str2double(s1);
s2 = s(5:6);
x2 = str2double(s2);
Longitude = x1 + x2/60
There are 60 minutes in a degree.
![Page 39: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/39.jpg)
Insight Through Computing
Numeric-to-String Conversion
x = 1234;
s = int2str(x); % s = ‘1234’
x = pi;
s = num2str(x,’%5.3f’); % s =‘3.142’
![Page 40: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/40.jpg)
Insight Through Computing
Problem
Given a date in the format ‘mm/dd’
specify the next day in the same format
![Page 41: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/41.jpg)
Insight Through Computing
y = Tomorrow(x)
x y
02/28 03/01
07/13 07/14
12/31 01/01
![Page 42: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/42.jpg)
Insight Through Computing
Get the Day and Month
month = str2double(x(1:2));
day = str2double(x(4:5));
Thus, if x = ’02/28’ then month is assignedthe numerical value of 2 and day is assigned the numerical value of 28.
![Page 43: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/43.jpg)
Insight Through Computing
L = [31 28 31 30 31 30 31 31 30 31 30 31];
if day+1<=L(month)
% Tomorrow is in the same month
newDay = day+1;
newMonth = month;
![Page 44: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/44.jpg)
Insight Through Computing
L = [31 28 31 30 31 30 31 31 30 31 30 31];
else
% Tomorrow is in the next month
newDay = 1;
if month <12
newMonth = month+1;
else
newMonth = 1;
end
![Page 45: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/45.jpg)
Insight Through Computing
The New Day String
Compute newDay (numerical) and convert…
d = int2str(newDay);if length(d)==1 d = ['0' d];end
![Page 46: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/46.jpg)
Insight Through Computing
The New Month String
Compute newMonth (numerical) and convert…
m = int2str(newMonth);
if length(m)==1;
m = ['0' m];
end
![Page 47: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/47.jpg)
Insight Through Computing
The Final Concatenation
y = [m '/' d];
![Page 48: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/48.jpg)
Insight Through Computing
Some other useful string functionsstr= ‘Cs 1112’;
length(str) % 7isletter(str) % [1 1 0 0 0 0 0]isspace(str) % [0 0 1 0 0 0 0]lower(str) % ‘cs 1112’upper(str) % ‘CS 1112’
ischar(str) % Is str a char array? True (1)strcmp(str(1:2),‘cs’) % Compare strings str(1:2) & ‘cs’. False (0)strcmp(str(1:3),‘CS’) % False (0)
![Page 49: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/49.jpg)
Insight Through Computing
ASCII characters(American Standard Code for Information Interchange)
ascii code Character: :: :65 ‘A’66 ‘B’67 ‘C’: :90 ‘Z’: :
ascii code Character
: :: :48 ‘0’49 ‘1’50 ‘2’: :57 ‘9’: :
![Page 50: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/50.jpg)
Insight Through Computing
Character vs ASCII code
str= ‘Age 19’
%a 1-d array of characters
code= double(str)
%convert chars to ascii values
str1= char(code)
%convert ascii values to chars
![Page 51: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/51.jpg)
Insight Through Computing
Arithmetic and relational ops on characters
• ‘c’-‘a’ gives 2• ‘6’-‘5’ gives 1• letter1=‘e’; letter2=‘f’; • letter1-letter2 gives -1
• ‘c’>’a’ gives true• letter1==letter2 gives false
• ‘A’ + 2 gives 67• char(‘A’+2) gives ‘C’
![Page 52: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/52.jpg)
Insight Through Computing
Example: toUpperWrite a function toUpper(cha) to convert character cha to upper case if cha is a lower case letter. Return the converted letter. If cha is not a lower case letter, simply return the character cha.
Hint: Think about the distance between a letter and the base letter ‘a’ (or ‘A’). E.g.,
a b c d e f g h …
A B C D E F G H …
Of course, do not use Matlab function upper!
distance = ‘g’-‘a’ = 6 = ‘G’-‘A’
![Page 53: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/53.jpg)
Insight Through Computing
function up = toUpper(cha)% up is the upper case of character cha.% If cha is not a letter then up is just cha.
up= cha;
cha is lower case if it is between ‘a’ and ‘z’
![Page 54: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/54.jpg)
Insight Through Computing
function up = toUpper(cha)% up is the upper case of character cha.% If cha is not a letter then up is just cha.
up= cha;
if ( cha >= 'a' && cha <= 'z' )
% Find distance of cha from ‘a’
end
![Page 55: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/55.jpg)
Insight Through Computing
function up = toUpper(cha)% up is the upper case of character cha.% If cha is not a letter then up is just cha.
up= cha;
if ( cha >= 'a' && cha <= 'z' )
% Find distance of cha from ‘a’ offset= cha - 'a';
% Go same distance from ‘A’ end
![Page 56: 15. Strings](https://reader035.vdocuments.us/reader035/viewer/2022081517/5681592d550346895dc65930/html5/thumbnails/56.jpg)
Insight Through Computing
function up = toUpper(cha)% up is the upper case of character cha.% If cha is not a letter then up is just cha.
up= cha;
if ( cha >= 'a' && cha <= 'z' )
% Find distance of cha from ‘a’ offset= cha - 'a';
% Go same distance from ‘A’ up= char('A' + offset);end