10.4 evidence of evolution evidence of evolution
TRANSCRIPT
10.4 Evidence of Evolution
The Fossil Record
Comparing fossils with living organisms reveals a pattern of gradual change from past to present.
*We will never find fossils of every species that ever lived.
10.4 Evidence of Evolution
Biogeography
Study of the locations of organisms around the world
Ostrich (Africa) Emu (Australia) Rhea (South America)
10.4 Evidence of Evolution
Movement of land forms can separate a group of organisms into two separate groups
10.4 Evidence of Evolution
Embryology
Scientists compare embryos to look for similar patters and structures
10.4 Evidence of Evolution
Anatomy
Scientists compare body structures of different species
– Homologous structures are similar in structure but different in function.
– Evidence of a common ancestor
10.4 Evidence of Evolution
Human hand
Bat wing
Mole foot
Fly wing
– Analogous structures are not evidence of a common ancestor.
– Analogous structures have a similar function.
10.4 Evidence of Evolution
Vestigial structures are remnants of organs or structures that had a function in an early ancestor.
(Ostrich wings, wisdom teeth, appendix, whale pelvic/leg bones)
10.4 Evidence of Evolution
Biochemistry
Comparing genes between species
AGTCCCGTAGGTCGATGTGGGTAAAAGCTTGATCG
AGTCCCGTACGTCGATGTGGGTATAAGCTTGATCG