sora

iv

a r t i c l e i n f o

Article history:Received 25 November 2014Received in revised form 4 March 2015Accepted 18 March 2015Available online 27 March 2015

remarkable therapeutic potential in local and systemic bacterialinfection, which highlights the potential value of the bacteriocinsas alternative to antibiotics (Cotter et al., 2013; Montalban-Lopezet al., 2011).

tter et al., 2014;are often cby accumausing inc

permeability and loss of barrier functions. Currently, onthree-dimensional structures of AS-48 (Maqueda et al.,carnocyclin A (Martin-Visscher et al., 2009) and subtil(Kawulka et al., 2004) are available. The longest of the circularbacteriocins (AS-48, circularin A and uberolysin A) are organizedinto ve a-helices while the shortest ones (carnocyclin A, lactocy-clicin Q, and leucocyclicin Q) contain just four amphipathic helices.In all cases, a-helices are tightly packed and connected by well-dened loops, which encompass a compact hydrophobic core withthe common architecture of the saposin fold (Maqueda et al., 2008;

Abbreviations: WT, wild type; MIC, minimal inhibitory concentration; CD,circular dichroism; PC, phosphatidylcholine; PS, phosphatidylserine. Corresponding author. Fax: +34 915642431.

E-mail address: xmjose@iqfr.csic.es (M.J. Snchez-Barrena).

Journal of Structural Biology 190 (2015) 162172

Contents lists availab

Journal of Struc

.e(broad spectrum). They are biotechnologically very relevant sincethese proteins generally show low eukaryotic toxicity and thus,they can be used in food industry as natural preservatives(Abriouel et al., 2010). Furthermore, some bacteriocins have a

et al., 2011; Montalban-Lopez et al., 2012; PoScholz et al., 2014; van Belkum et al., 2011). Theyand amphiphilic molecules that kill bacterial cellsor insertion into the membrane, thereby chttp://dx.doi.org/10.1016/j.jsb.2015.03.0061047-8477/ 2015 Elsevier Inc. All rights reserved.ationiculationreasedly the2004),osin A1. Introduction

Bacteriocins are ribosomally synthesized defence proteinsactive against related bacteria (narrow spectrum) or across genera

AS-48 is the archetype of the growing family of circular bacteri-ocins, which are exclusively produced by Gram-positive bacteria.To date, thirteen different globular circular bacteriocins, rangingfrom 58 to 70 amino acids, have been reported (Martin-VisscherKeywords:BacteriocinAntimicrobial peptideMembrane bilayerLipid binding proteinX-ray crystallographya b s t r a c t

The molecular mechanism underlining the antibacterial activity of the bacteriocin AS-48 is not known,and two different and opposite alternatives have been proposed. Available data suggested that theinteraction of positively charged amino acids of AS-48 with the membrane would produce membranedestabilization and disruption. Alternatively, it has been proposed that AS-48 activity could rely on theeffective insertion of the bacteriocin into the membrane. The biological and structural properties of theAS-48G13K/L40K double mutant were investigated to shed light on this subject. Compared with the wildtype, the mutant protein suffered an important reduction in the antibacterial activity. Biochemical andstructural studies of AS-48G13K/L40K mutant suggest the basis of its decreased antimicrobial activity.Lipid cosedimentation assays showed that the membrane afnity of AS-48G13K/L40K is 12-fold lower thanthat observed for the wild type. L40K mutation is responsible for this reduced membrane afnity andthus, hydrophobic interactions are involved in membrane association. Furthermore, the high-resolutioncrystal structure of AS-48G13K/L40K, together with the study of its dimeric character in solution showedthat G13K stabilizes the inactive water-soluble dimer, which displays a reduced dipole moment. Our datasuggest that the cumulative effect of these three affected properties reduces AS-48 activity, and point outthat the bactericidal effect is achieved by the electrostatically driven approach of the inactivewater-soluble dimer towards the membrane, followed by the dissociation and insertion of the proteininto the lipid bilayer.

2015 Elsevier Inc. All rights reserved.bDepartamento de Cristalografa y Biologa Estructural, Instituto de Qumica Fsica Rocasolano, Consejo Superior de Investigaciones Cientcas, Madrid, SpainThe bacteriocin AS-48 requires dimer dishydrophobic interactions with the memb

Rubn Cebrin a, Manuel Martnez-Bueno a, Eva ValdMara Jos Snchez-Barrena b,aDepartamento de Microbiologa, Facultad de Ciencias, Universidad de Granada, Spain

journal homepage: wwwciation followed byne for antibacterial activity

ia a, Armando Albert b, Mercedes Maqueda a,

le at ScienceDirect

tural Biology

lsev ier .com/ locate/y jsbi

cturMartin-Visscher et al., 2008, 2011; van Belkum et al., 2011). Thehead-to-tail union occurs within one a-helix, as has beenconrmed for AS-48 and carnocyclin A. This may be a key factorin the maturation process andmay be determinant for protein fold-ing (Sanchez-Hidalgo et al., 2011). In contrast, subtilosin A (a circu-lar lantibiotic) assumes a twisted bowl-like structure, with mostside chains pointing toward the solvent (Kawulka et al., 2004).The general trend in their biosynthesis involves the synthesis ofan N-terminal pre-propeptide that undergoes post-translationalcircularization after the proteolytic cleavage of its leader sequence.In fact, the precursors are post-translationally modied to join theN- and C-termini with a peptide bond. Circularization appears toconfer a range of potential advantages: increased resistance to pro-teases and thermodynamic stability. These features improve theirbiological activity and also confer robustness for biotechnologicalapplications. AS-48 has one of the widest spectra described amongthis family of proteins and it is active against several Gram-positiveand some Gram-negative bacteria (Maqueda et al., 2008, 2004). Forthese reasons, AS-48 is a rst-class candidate as natural food pre-servative and for medical and veterinary applicability.

The antimicrobial, physicochemical and structural character-ization of AS-48 have been studied (Abriouel et al., 2001; Galvezet al., 1991, 1986; Gonzalez et al., 2000; Maqueda et al., 2004;Martinez-Bueno et al., 1994; Samyn et al., 1994; Sanchez-Barrenaet al., 2003; Sanchez-Hidalgo et al., 2011). One of the most strikingfeatures of AS-48 structure is the amphipathic character of itsmolecular surface. A plane dened by four glutamic acids segre-gates a region rich in positively charged residues (nine Lys residuesare clustered in the H4 and H5 helices) from the remaininguncharged and hydrophobic surface (Sanchez-Barrena et al.,2003). Based on the monomeric NMR structure at pH 3, Gonzalezet al. (2000) proposed a mechanism for antimicrobial activity bywhich positively charged amino acids of monomeric AS-48 wouldbind to the membrane surface, and thus the accumulation of mole-cules on the membrane surface would destabilize the bacterialmembrane and would induce the formation of pores. To providemore insights on the molecular mechanism of action of AS-48,the crystal structure of AS-48 was solved and the analysis of theassociation state in solution was studied (Sanchez-Barrena et al.,2003). The X-ray structure indicated that the protein displaystwo different oligomeric states according to the physicochemicalenvironment: a water-soluble dimeric form (DF-I) wherehydrophobic interactions mediate dimer formation and an amphi-pathic, membrane-bound dimeric form II (DF-II) where hydrophiliccontacts occur between protomers and hydrophobic residues areexposed to the solvent. The two crystal structures of wild typeAS-48 at pH 4.5 and 7.5 unambiguously showed the direct interac-tion of Glu residues with a sulfate ion (SO42) and a phosphate ion(H2PO4) respectively, that were located between the DF-II pro-tomers. The crystallization of AS-48 in the presence of detergentsalso showed the direct interaction of the hydrophobic solvent-exposed residues with the aliphatic chain of a detergent molecule.Finally, analytical ultracentrifugation experiments indicated thatAS-48 is a dimer in solution. Taken together, all these data sug-gested that DF-I is the structure of AS-48 in solution and its strongdipole moment could drive the approach to the bacterial mem-brane. At the membrane surface, the acidic pH would destabilizeAS-48 DF-I due to the protonation of the glutamic acid side chainsand this would promote the rearrangement from the water-solubleDF-I to the membrane bound protein, in order to insert into themembrane. Protonated glutamic acids would recognize the phos-phate group of phospholipids, as the crystal structure of AS-48showed, and positive charged and hydrophobic residues would

R. Cebrin et al. / Journal of Struinteract with the polar head groups and the aliphatic chains ofphospholipids, respectively. Recent coarse-grained simulationshave shown that AS-48 would be able to insert into the bacterialmembrane (Cruz et al., 2013). However, there are scarce experi-mental data supporting the mechanism of membrane insertion.

The ribosomal origin of these antibacterial proteins enablesstrategies to modify the peptide sequence and create variants withaltered biological and physicochemical properties. Severalmutagenesis assays have been carried out in the structural geneof the nisin protein with the aim of understanding the importanceof each substitution and rationalize the way to improve its antimi-crobial activity and selectivity (Field et al., 2008, 2010, 2012;Molloy et al., 2013; Rink et al., 2007; Rollema et al., 1995; Rouseet al., 2012; Yuan et al., 2004). Likewise, directed mutagenesisstudies have been carried out to manipulate the structural as-48Agene and understand the molecular mechanism of action of thisbacteriocin. Engineered AS-48 derivatives were obtained byreplacement of the pre-propeptide-encoding gene by the mutatedversions, followed by in vivo peptide production (Sanchez-Hidalgoet al., 2011). Therefore, it was shown that the substitution of Gluresidues 4, 20, 49 and 58 to Ala decreased the antimicrobial activ-ity of AS-48, which would support the suggested role of theseamino acids in recognizing the phosphate groups of the bacterialmembrane (Sanchez-Barrena et al., 2003). In another study, surfaceexposed Gly-13 and Leu-40 were separately replaced with Lys,showing no effect on the antimicrobial activity of AS-48 againstthe tested bacteria (Sanchez-Hidalgo et al., 2010).

To gain more insights into the membrane mediated mechanismunderlying the antimicrobial activity of AS-48, we have simultane-ously mutated two surface exposed residues Gly-13 and Leu-40 toLysine. Based on the insertion mechanism proposed by Sanchez-Barrena et al. (2003), Leu-40, would be completely embedded inthe membrane, reaching the center of the lipid bilayer and Gly-13would be at the membrane interface, where phospholipids polarheads are located. The presence of Lys residues at those positionswould have a potential effect on the antimicrobial activity if theprotein would insert into the membrane. Indeed, our data showthat the AS-48G13K/L40K double mutant has an important reductionof its antimicrobial activity and the single mutations have aninhibitory effect against the most sensitive bacterial strain,Arthrobacter sp. Membrane binding experiments with the doubleand single mutants, together with the analysis of the crystal struc-ture and studies of the dimeric character of the G13K/L40K mutantprotein in solution suggest that the decreased antibacterial activityobserved is linked to the ability of this dimeric protein to approach,dissociate and hydrophobically interact with the membrane. Ourexperimental data support that the antimicrobial function ofAS-48 is achieved by the electrostatically driven approach of theinactive water-soluble dimer towards the membrane, followed bythe dissociation and insertion of the protein into the lipid bilayer.

2. Experimental procedures

2.1. Bacterial strains and culture conditions

The bacterial Gram-positive strains used in this study (Listeriamonocytogenes CECT (Spanish Type Culture Collection) 4032,Listeria innocua CECT 4030, Staphylococcus aureus CECT 240,Enterococcus faecalis JH2-2, Bacillus cereus LWL1 and Arthrobactersp.) were, in all cases, susceptible against native AS-48. The plas-mid-free E. faecalis JH2-2 strain was used in cloning experimentsand heterologous production of AS-48 and its variant as well asan indicator strain. All Gram-positive bacteria were grown over-night without aeration in brainheart infusion (BHI, Scharlau,Barcelona, Spain) at 37 or 28 C. Escherichia coli strain, used asintermediate hosts for cloning, was grown in LuriaBertani (LB,

al Biology 190 (2015) 162172 163Scharlau) at 37 C. Agar plates contained 1.5% w/v agar, and softagar was made with 0.75% w/v agar. If necessary, media were buf-fered in 0.1 M sodium phosphate buffer, pH 7.2. When appropriate,

the antibiotics ampicillin, 50 lg/ml, and chloramphenicol, 20 lg/ml, both from SigmaAldrich (Madrid, Spain) were added as selec-tive agents.

2.2. Plasmids and DNA manipulations

All plasmids used in this work and their relevant characteristicsare shown in Table 1. DNA cloning techniques and transformationswere performed according to standard protocols. E. coli JM109 andE. faecalis plasmids DNA were extracted according to Birnboim andDoly (1979), OSullivan and Klaenhammer (1993), respectively. E.faecalis was transformed by electroporation according toFriesenegger et al. (1991). Restriction enzymes, T4 DNA ligase,shrimp phosphatase and other DNA-modifying enzymes are fromFermentas (Quimigen, Madrid, Spain) and Roche Diagnostics (SanCugat del Valls, Spain) and they were used as recommended bythe suppliers. Synthetic oligonucleotides were provided byBiomedal Life Science (Sevilla, Spain). DNA was sequenced usingan ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction

(pBgD12SG13K/L40K) was used to transform competent cells fromE. coli JM109. The absence of undesirable mutations in the ampli-ed fragments was veried by DNA sequencing. To restore theas-48 cluster, the plasmid containing the two required sub-stitutions, were SphIBglII digested and cloned into pAM401-76by replacing the equivalent fragment (pAM401-76G13K/L40K) (Diazet al., 2003). Finally, ligation of the C fragment (BglII) (6.4 kb) frompBgC plasmid into pAM401-76G13K/L40K, previously digested withthe same enzyme, yielded the desired pAM401-81G13K/L40K con-struction (25 kb). The proper orientation of the fragments wasestablished by PCR analysis using the As48-1 and As48-B4 specicprimers (Table 1).

2.4. AS-48 and engineered derivatives purication

Enterococcal producers of AS-48, the engineered AS-48G13K/L40Kdouble mutant, and the AS-48G13K and AS-48L40K single mutantsdescribed by Sanchez-Hidalgo et al. (2010), were cultured at37 C in Esprion 300 (E-300, DMV Int., Veghel, Netherland) plus

80 (ustes-48the

MB2in)in

TTG

CC

164 R. Cebrin et al. / Journal of Structural Biology 190 (2015) 162172(Perkin Elmer, Applied Biosystems, USA).

2.3. Mutagenesis procedure and pAM401-81G13K/L40K plasmidconstruction

We adopted the site-directed mutagenesis method on the as-48A structural gene as described (Sanchez-Hidalgo et al., 2008)but without the XhoI restriction site that conferred a hypoproducerphenotype. Briey, the two base substitutions were carried out inthe structural gene as-48A cloned into pBgD12s by inverse-PCRusing the Pwo polymerase (Roche Diagnostics). The different pairsof mismatched oligonucleotides with each of the desired muta-tions used as primers for mutagenesis are shown in Table 1. Foreach mutation a pair of primers that annealed at their 50-endsand containing the desired mutation were synthesized to amplifythe desired plasmids. First pBgD12SG13K was obtained in this workand them used as template to obtain the double mutantpBgD12SG13K/L40K by the same method. Mutagenesis reaction mix-tures containing 50 ng of plasmid were used at a total volume of50 ll, containing 1 unit of Pwo polymerase, 0.05 mM of eachdNTP (Eppendorf) and 10 pmol of each primer. PCR was performedin 15 cycles, each cycle consisting of a denaturing step at 96 C for50 s, a primer-annealing step at 54 C for 45 s and an extensionstep at 72 C for 10 min. The PCR mixture was DpnI digested toeliminate parental DNA. The 5.4-kb amplied product

Table 1Relevant features of the plasmids and oligonucleotides used in this work.

Plasmids Characteristics

pBgD12S Apr, as-48A structural gene cloned into pSL11pBgC Apr, region BglIIBglII (fragment C) of AS-48 clpBgD12SG13K Apr, pBgD12S with G13K substitution in the apBgD12SG13K/L40K Apr, pBgD12S with G13K/L40K substitution inpAM401 Cmr, Tcr, bifunctional vector E. coli-E. faecalispAM401-76 Cmr, fragment D y B (genes as-48A, G, H) of ppAM401-76G13K/L40K Cmr, pAM401-76 with G13K/l40K substitutionpAM401-81 Cmr, as-48 cluster cloned into pAM401 (25 kbpAM401-81G13K/L40K Cmr, pAM401-81 with G13K/l40K substitution

Oligonucleotides Sequence 50-30

As48-5 CCAAGCAATAACTGCTCTTTAs48-6 GAGTATCATGGTTAAAGAAAAs48-1 AATAAACTACATGGGTAs48-B4 AATCCTATTACTACAATAAG13K-AS48_fw CCAGCAGCAGTTGCAAAAACTGTGCTTAATGTAGG13K-AS48_rv CATTAAGCACAGTTTTTGCAACTGCTGCTGGTATA

L40K-AS48_fw TAGCGGAGGTAAATCTTTACTCGCTGCAGCAGGAAGL40K-AS48_rv CAGCGAGTAAAGATTTACCTCCGCTACCTACAGCAGT1% glucose (E-300-G) following the conditions established byAnanou et al. (2008). The cultures were applied directly onto aCM25 cation exchanger (Amersham Biosciences Europe). To avoiddialysis during the second purication step, eluted fractions fromCM25 were applied to a hydrophobic C18 column and nally pur-ied to homogeneity by reversed-phase, high-performance liquidchromatography (RP-HPLC) on a Vydac 218TP510 semipreparativecolumn (The Separation Group, Hesperia, CA) previously equili-brated in solvent A (10 mM triuoroacetic acid, TFA; Fluka), at aow rate of 5 ml/min as described elsewhere (Abriouel et al.,2003). The concentration of puried derivatives, determined bymeasuring UV absorption at 280 nm in a Nanodrop, was convertedto protein concentration using molecular extinction coefcientscalculated from the contributions of individual amino acid residuesintroduced (Gill and von Hippel, 1989).

2.5. Circular dichroism

The secondary structure of AS-48G13K/L40K mutant was com-pared with the wild-type AS-48 using Far-UV circular dichroism(CD) spectra, recorded with a Jasco J815 CD spectrometer (JascoInc., Madrid, Spain) equipped with a JASCO CDF-4265/15 Peltieraccessory. The protein concentrations were 2 lM in 10 mM phos-phoric buffer pH 3.0. CD measurements were taken at 20 C usinga 0.5 mm path length cuvette. Spectra were acquired from 260 to

Source

5.4 kb) Sanchez-Hidalgo et al. (2008)r cloned into pSL1180 (9.2 Kb) Diaz et al. (2003)A structural gene (5.4 Kb) This workas-48A structural gene (5.4 Kb) This work

Wirth et al. (1986)cloned in pAM401 (18.9 kb) Diaz et al. (2003)

the as-48A structural gene (18.9 kb) This workDiaz et al. (2003)

the as-48A structural gene (25 kb) This work

AAGCTGGTGGATG

GAACTCTTTAGAGAG

AAGAATTG

experiment permitted the determination of the membrane afnity(dissociation constant, Kd), as shown by Gasset et al., 1989.

2.9. Crystallization, diffraction data collection and structure solution

AS-48G13K/L40K was concentrated to 18 mg/ml in buffer 10 mMTrisHCl pH 7.5 for crystallization trials. Needle-like crystals wereobtained using sitting-drop vapour-diffusion techniques in 0.2 Mammonium acetate, 30% PEG4K, 0.1 M sodium citrate tribasic dihy-drate pH 5.6. These crystals did not diffract so they were improvedusing the Hampton Research detergent screen. Plate-like crystalswere obtained from drops containing ANAPOE-58, n-tetradecyl-b-D-maltoside or Pluronic F-68. They diffracted beyond 1.5 ,were of space group P21 and unit cell dimensions were the same.The crystals grown in the presence of ANAPOE-58 diffracted tohigher resolution (1.2 ). They were cryoprotected by increasingthe PEG4 K concentration to 35%, mounted in a ber loop and cry-ocooled in liquid nitrogen for data collection.

A complete data set was collected on beamline ID14-4 at theESRF, Grenoble. The diffraction data were processed usingMosm (Leslie, 2006) and scaled with Scala (Evans, 2006). Thestructure of the wild-type AS-48 protein (PDB code 1O82, chainA) was used to solve the mutant structure by molecular replace-ment with Phaser (McCoy et al., 2007). Two molecules were foundin the asymmetric unit. The structure was rened at 1.2 using

ctural Biology 190 (2015) 162172 165190 nm at a scan rate of 50 nmmin1, with a response time of 1 s.For each protein, a baseline scan (phosphoric buffer pH 3.0) wassubtracted from the average of ten scans to give the nal averagedscan.

2.6. Biological activity assays and determination of minimal inhibitoryconcentration

The antibacterial activities of JH2-2 (pAM401-81) and JH2-2(pAM401-81G13K/L40K) double transformants were assayed bydeferred antagonism assay as described (Sanchez-Hidalgo et al.,2008). Activity was assessed by measuring the diameter of theinhibition zone after incubation at 28 or 37 C for 18 h.

The antimicrobial activity of proteins separated by SDSPAGEwas also carried out according to the method reported by Bhuniaet al. (1987). Similar amounts of wild type and AS-48 derivatives(5 lg) were separated by SDSPAGE electrophoresis on 10% slabgels as described by Laemmli (1970). Gels were stained withCoomassie brilliant blue R-250. Due to its circular character, AS-48 migrates as if it had a lower molecular weight.

Determination of the minimal inhibitory concentration (MIC) ofhighly puried derivative preparations (dened as the minimalconcentration of bacteriocin that inhibited growth of the indicatorstrain) was carried out by the spot-on-lawn assays. The prepara-tions were serially diluted in sterile distilled water and spots of3 ll were deposited onto plates previously overlaid with 6 ml ofbuffered BHA soft agar inoculated with the indicator strain.Plates were incubated overnight at the appropriate temperaturesand examined for halos of inhibition. Native AS-48 samples wereused as positive control. Two independent experiments startingfrom two different protein stocks were performed.

2.7. Liposome cosedimentation assays

Synthetic liposomes were prepared by mixing 75/25% or 85/15%phosphatidylcholine (PC)/phosphatidylserine (PS) (SigmaAldrich;biological source: PS was extracted from bovine brain and PC, fromegg yolk). Once desiccated in a non-oxidizing atmosphere, lipidswere hydrated in buffer 20 mM Hepes pH 7.4, 150 mM NaCl, to anal concentration of 1 mg/ml. The sample was sonicated for20 s. The liposomes were subsequently passed through 0.8 mmNucleopore polycarbonate lters (Whatman) 9 times by syringeextrusion. Wild type, G13K/L40K, G13K and L40K mutant proteins(at 0.2 mg/ml nal concentration) were incubated for 30 min with0.5 mg/ml liposomes. The solutions were then centrifuged at65,000 rpm in a TLA100 rotor (Beckman) for 15 min. A controlexperiment was performed and the protein samples were cen-trifuged in the absence of liposomes. Supernatant and pellet frac-tion were separated and resuspended in equal volumes ofreducing sample buffer and run on 15% SDSPAGE gels. Threeindependent experiments were performed.

2.8. Membrane afnity calculations

Liposome cosedimentation assays were performed as describedabove for WT and G13K/L40K mutant proteins, at a given proteinconcentration and increasing amounts of lipids (75/25% PC/PS).After centrifugation, the concentration of protein in the super-natant fractions was measured with a spectrophotometer. Threereplicas were performed for each lipid:protein ratio. Taking intoaccount the total amount of protein added to the experiment(PT), and that remaining in the supernatant fractions after liposome

R. Cebrin et al. / Journal of Strusedimentation (unbound protein, PU), the amount of membranebound protein (PB) was calculated. This value, together with thetotal amount of lipids (LT) and protein (PT) added in eachRefmac (Murshudov et al., 1997). Models were updated usingCoot (Emsley and Cowtan, 2004). The stereochemistry of the modelwas veried with MolProbity (Chen et al., 2010). See Table 2 forfurther details on the data processing and renement. Analysis ofthe structure was done with CCP4i programs (Winn et al., 2011)and images were drawn with CCP4mg (McNicholas et al., 2011).The crystal structure and structure factors have been depositedin the Protein Data Bank (PDB code 4RGD).

2.10. Gel ltration chromatography

300 lg of pure wild type and AS-48G13K/L40K mutant, as well asmolecular weight standards (BioRad) were applied to a gel

Table 2Data collection and renement statistics.

Data collectionStrategy 180, Du 0.5Wavelength () 0.9762Space group P21a, b, c () 32.82, 49.91, 41.72a, b, c () 90.00, 98.16, 90.00Resolution () 41.301.20 (1.221.20)Rmerge (%) 7.5 (53.6)Mean I/r(I) 8.8 (2.4)Completeness (%) 100 (99.9)Multiplicity 3.5 (3.5)

RenementResolution () 24.101.20 (1.2311.200)No. reections 39,619Test set size (%) 5.0Rwork (%) 11.8 (21.2)Rfree (%) 14.7 (23.3)No. atoms (non-H) 1389No. water molecules 305hBi (2) 12.5R.m.s. deviationsBond length () 0.02Bond angle () 1.99

Ramachandran plot

In favoured regions (%) 100%Outliers (%) 0

ltration column (Superdex 75 HR 10/30, GE Healthcare) equili-brated with buffer 20 mM TrisHCl pH 7.5, 50 mM NaCl. The pro-teins anomalously migrated through the column and consideringtheir molecular weight, they eluted at lower mass indicating someinteraction with the resin. This might be explained by the amphi-pathic nature of its macromolecular surface.

2.11. Analytical ultracentrifugation

Equilibrium sedimentation experiments with wild type and AS-48G13K/L40K mutant were done in a Beckman Optima XL-A ultracen-trifuge at 20 C, using a Ti50 rotor and 6-sector centrepieces, at280 nm and at 17,000 and 29,000 rpm. Data were analyzed withHeteroAnalysis (Cole & Lary). The weight-average molecularmasses were calculated using data from 17,000 and 29,000 rpmruns. Partial specic volume was calculated from the proteinsequence to be 0.7341 using Sedenterp software (J. Philo).Protein concentration was 0.17 mg/ml and buffer conditions50 mM TrisHCl pH 7.5.

3. Results and discussion

3.1. Biological characterization of the AS-48G13K/L40K double mutant

Surface-exposed residues Gly-13 and Leu-40 were simultane-ously replaced by lysine into de as-48A structural gene by site-di-rected mutagenesis using inverse PCR technique in two steps. Torestore the full expression of AS-48, the double-engineered genewas introduced into the as-48 cluster as described elsewhere

(Sanchez-Hidalgo et al., 2008). The JH2-2 (pAM401-81G13K/L40K)transformants exhibited no activity when assayed by deferredantagonism against whichever of the susceptible bacteria used,including the most sensitive ones, L. monocytogenes andArthrobacter sp (Fig. 1A). A control experiment was performed withJH2-2 (pAM401-81) transformant to conrm that both transfor-mants secreted similar amounts of protein (Fig. 1B). It is interestingto note that the individual changes G13K or L40K did not affect theactivity and/or stability of the derivative molecules (Sanchez-Hidalgo et al., 2010). However, we have veried in this work thatindividual mutations are capable of inhibiting the recently isolatedArthrobacter sp., used as indicator strain due to the high sensitivityagainst AS-48. Interestingly, this strain is more resistant againstpuried AS-48G13K than AS-48L40K single mutants, requiring 7.50versus 2.80 ng/ll to be inhibited (Table 3).

SDSPAGE gels were run and subsequently treated to removeSDS and determine the inhibitory activity against the most sensi-tive strain, Arthrobacter sp (Fig. 1B). Notably, the sizes of the inhi-bition zones were not correlated with the intensity of the proteinbands, conrming the loss of activity previously detected (Fig. 1B).

To calculate the minimal inhibitory concentration,AS-48G13K/L40K was puried following the same procedures asestablished for WT AS-48, AS-48G13K and AS-48L40K (seeSection 2). In accordance with the more polar character, theAS-48G13K/L40K mutant eluted slightly earlier than the WT proteinfrom the reversed-phase column (Fig. 2A). The purity of G13K/L40K protein was assessed by SDSPAGE (Fig. 2B). The integrityof the folding was veried by circular dichroism. The far-UV spec-tra for the WT and double mutant proteins were collected and nosignicant differences were found in their secondary structures

01-8cytoE of

166 R. Cebrin et al. / Journal of Structural Biology 190 (2015) 162172Fig.1. Biological activity of AS-48G13K/L40K. (A) Antibacterial activity of JH2-2(pAM4several indicator Gram-positive strains: A, Listeria innocua CECT 4030; B, Listeria monoBacillus cereus LWL1 and F, Arthrobacter sp. (B) Left, coomassie blue-stained SDSPAG

Lane 1 shows molecular weight markers (SigmaMarker Low Range, SigmaAldrich). Momigrates as if it had lower molecular weight. Right, direct detection of the activity of these(1987).1) (top) and JH2-2(pAM401-81G13K/L40K) (bottom) by deferred antagonism againstgenes CECT 4032; C, Staphylococcus aureus CECT240; D, Enterococcus faecalis S-47; E,semipuried samples of AS-48G13K/L40K (lane 3) using WT AS-48 as control (lane 2).

lecular weights (kDa) are indicated. Due to their circular character, AS-48 proteinsamples against Arthrobacter sp. developed according to the method of Bhunia et al.

(Fig. 2C). Determination of the minimal inhibitory concentration(MIC) corroborated the very detrimental effects of the introducedsubstitutions on the antibacterial activity (Table 3). Compared withthe WT protein, the double mutant needed signicantly higherMICs (12-fold to 16-fold increase for the majority of the bacteriaused) for inhibition. Remarkably, Arthrobacter sp., the most sus-ceptible bacteria, needed an AS-48G13K/L40K concentration 87-foldhigher than the WT to be inhibited. Interestingly, the single point

3.2. The interaction of AS-48 with membranes

To elucidate the molecular basis of the antibacterial mechanismof AS-48 we compared the membrane binding properties of the AS-48G13K/L40K, AS-48G13K and AS-48L40K mutants with those of thewild type protein. We had previously conrmed the ability of AS-48 to interact with liposomes prepared with phosphatidylcholine(Galvez et al., 1991). We conducted lipid cosedimentation assayswith synthetic liposomes prepared with phosphatidylcholine andphosphatidylserine. The experiments showed that at 75/25% PC/PS the amount of WT protein bound to membranes is similar tothat found for the G13K mutant. Conversely, L40K and G13K/L40K displayed a similar behaviour and bound less efciently tomembranes than the WT and G13K mutant (Fig. 3A).Furthermore, at 85/15% PC/PS, the amount of WT or G13K/L40KAS-48 proteins bound to membranes decreased compared with75/25% PC/PS, indicating that the mechanism of membrane inter-action is charge dependent (Fig. 3A).

To gain more insights into the ability of AS-48 to interact withmembranes, we performed quantitative lipid cosedimentationassays at increasing liposome/protein molar ratios to calculatethe membrane binding afnity of the WT and the double mutantproteins (Fig. 3B). The dissociation constant (Kd) for the WT andG13K/L40K mutant are 9.7 and 113.9 lM, respectively. That is,

Table 3Activity of AS-48 mutants against different susceptible bacterial strains. Minimalinhibitory concentration of highly puried preparations serially diluted in sterilewater (protein concentration measurements have an error of 2%). Activity of the WTAS-48 was determined as a control.

Indicator strain Concentration assayed (ng/ll) AS-48mutant/AS-48WT ratioWT G13K L40K G13K/

L40K

E. faecalis JH2-2 3.90 62.50 16.02L. monocytogenes

CECT 40320.97 11.71 12.07

L. innocua CECT4030

3.90 62.50 16.02

S. aureus CECT 240 15.62 250.00 16.00Arthrobacter sp. 0.18 7.50 2.80 15.62 *41.66./15.56/86.78

* Ratios for G13K, L40K and G13K/L40K, respectively.

R. Cebrin et al. / Journal of Structural Biology 190 (2015) 162172 167mutants, AS-48G13K and AS-48L40K needed 42 and 15-fold concen-tration increase to be inhibited, respectively, indicating thatG13K substitution is more relevant than L40K. Furthermore, thesedata also show that the combined effect of each mutation is morepronounced than the effect of each independent mutation(Table 3). The decreased antibacterial activity of the surfaceexposed mutant forms of AS-48 against Arthrobacter sp. withrespect to the other indicator strains assayed could be explainedby the hydrophobic characteristics of the cell wall of this bac-terium belonging to Phylum Actinobacteria (van Loosdrechtet al., 1987) and the more polar character of these derivativebacteriocins with extra positive charges. Additionally, these resultsindicate that it is possible the use of site-directed mutagenesis toengineer AS-48 and to obtain variants exclusively active againstspecic strains.Fig.2. Purication and circular dichroism. (A) Reverse-phase high-performance liquid chPAGE of the nal WT and AS-48G13K/L40K proteins used for the MIC assay, biochemical andthe Far-UV circular dichroism spectra recorded for WT (green) and AS-48G13K/L40K (bluethe WT protein displays 12-fold higher membrane afnity com-pared to the double mutant. This suggests that the AS-48 activitydoes not solely depend on electrostatic effects. Indeed, the affectof the individual mutations shows that while L40K displays adecreased membrane interaction, G13K does not show an affecton the membrane binding. This clearly shows that Leu-40, whichis located in a large hydrophobic patch (Fig. 3C and D), is directlyinvolved in the membrane binding process supporting a mecha-nism mediated by hydrophobic iterations.

All together, the membrane binding experiments suggest thatalthough the mechanism for membrane interaction is chargedependent, and the 10 surface exposed Lys/Arg residues have animportant role in membrane binding, hydrophobic interactions,such as those mediated by Leu-40, also participate in this process(Fig. 3C and d). Considering the amphipathic character of theromatography of WT and AS-48G13K/L40K mutant. (B) Coomassie blue-stained SDS-crystallographic studies. Molecular weights (kDa) are indicated. (C) Superposition of) proteins.

ctur168 R. Cebrin et al. / Journal of Strumolecular surface of the protein and the fact that both, positivecharges and hydrophobic residues, are important for membraneinteraction, our results support a membrane insertion mechanism,according to that proposed by Sanchez-Barrena et al. (2003) andsimilarly to the case of other cationic antimicrobial peptides(Dathe et al., 2001).

A membrane insertion model of AS-48 based on the structure ofthe wild type protein bound to the detergent molecule n-Decyl-b-

D-maltoside suggested that H1, H2 and H3 helices, rich inhydrophobic residues, would insert into the lipid bilayer andcharged helices H4 and H5, the C-terminal end of helix H1 andthe loop connecting helices H3 and H4 would interact with thenegatively charged phospholipid polar heads (Fig. 3C and D)(Sanchez-Barrena et al., 2003). In this model, residue Lys-40,located at helix H3, would be completely embedded in the mem-brane, reaching the centre of the lipid bilayer (Fig. 3C and D).Lys-40 would hinder the proper insertion of AS-48 into the mem-brane since it would generate repulsions with the hydrophobicregion of the lipid bilayer and this is in agreement with theobserved antimicrobial activity of the AS-48L40K mutant againstArthrobacter sp and the membrane binding assays (Fig. 3A). Onthe contrary, Gly-13, which would be located closer to the mem-brane interface (Fig. 3C and D), could accommodate its side-chainin this environment. Membrane binding experiments indicate thethis mutation does not affect membrane binding (Fig. 3A),

Fig.3. The binding of AS-48G13K/L40K to membranes. (A) Lipid cosedimentation assaysproteins. Supernatant (S) and precipitated (P) fractions after protein:liposome incubationMembrane afnity calculations. Lipid cosedimentation assays at increasing liposome/prPU = unbound protein; LT and PT, total amount of lipids and protein added to the experimeprotein bound to liposomes. In the upper graph, means + S.D. (n = 3) are given. The bottmolecules involved in the binding). n is the intersection of the line with the y axis , andmembrane-bound AS-48G13K/L40K. The structure of the wild type AS-48 (PDB code 1O82)blue/red sticks and mutations are indicated. (D) Molecular surface representation of thenegatively charged amino acids are coloured in blue/red and hydrophobic amino acidsal Biology 190 (2015) 162172however, G13K mutation also shows a negative effect on theantimicrobial activity, even more pronounced, 2.7-fold, than Lys-40 (Table 3). This clearly suggests that the antimicrobial effect ofG13K mutation is related to a molecular mechanism other thanthe direct interaction with the membrane.

3.3. The water-soluble form of AS-48G13K/L40K mutant

The X-ray structure of AS-48G13K/L40K mutant was solved bymolecular replacement at 1.2 and using as search model thestructure of the wild type protein (1O82 PDB code) (Fig. 4A). Thesuperimposition of the WT and double mutant protomers indicatesthat both structures are very similar (r.m.s.d. value for Ca atoms of0.44 relative to 1O82) (Fig. 4B). The Lys-13 and Lys-40 pointmutations are clearly dened in the electron density, they arelocated at the molecular surface of the protein and they do nothave any impact on the folding of AS-48 protomer. The G13K/L40K mutant protein was crystallized in the presence of three dif-ferent detergents (see Section 2). The structure and packing foundin the three crystals were virtually the same and no ordered deter-gent molecules were observed.

We found a dimer in the asymmetric unit that displays thesame topology as the wild type water-soluble dimeric form(Sanchez-Barrena et al., 2003), but the relative position of the pro-tomers is different (Fig. 4BD). The analysis of the mutant structure

with synthetic liposomes of WT, AS-48G13K, AS-48L40K and AS-48G13K/L40K mutantand centrifugation are shown. A control experiment with no liposomes is shown. (B)otein molar ratios of WT (black circles) and AS-48G13K/L40K mutant (white circles).nt. The WT and G13K/L40K PT values were 70 and 50 lM, respectively. PB, amount ofom graph allows the calculation of the Kd and n (being the number of phospholipidKd is the slope of the line divided by n. (C) Ribbon representation of a model of theis been used as a template. Positively/negatively charged amino acids are shown inmembrane-bound AS-48G13K/L40K model. Left: same orientation as in (C). Positively/in yellow. Mutations are indicated.

ctural Biology 190 (2015) 162172 169R. Cebrin et al. / Journal of Strushows that Lys-13 (protomer A), located in helix H1, is part of thedimer interface and Lys-40, placed at helix H3, is solvent exposed(Fig. 4B and C). To discard an effect of the crystal packing on theobserved reorganization of the dimeric structure, we analyzedthe three reported wild type structures (PDB codes 1O82, 1O83and 1O84) (20) that show identical dimeric structure despite theydisplay different crystal packing environments and were crystal-lized in different conditions (Fig. 4E). Taking 1O82 dimeric struc-ture as a reference, r.m.s.d. value for Ca atoms of 1O83 and 1O84structures are 0.11 and 0.47 , respectively. However, the mutantdimer is signicantly different to the WT and r.m.s.d. values forCa atoms is 2.88 .

The analysis of the AS-48G13K/L40K dimer interface shows thatG13K mutation forms a H-bond and multiple hydrophobic contactswith Ala-34 (protomer B) that are not present in the native struc-ture. These new interactions could promote the reorganization ofthe dimeric form and can be described as follows: taking protomerA as the reference, the helices H1 and H2 from protomer B movebackwards and laterally so that Ala-34 (protomer B) gets closeenough to Lys-13 (protomer A) for interaction and H-bond forma-tion (Fig. 4C and D).

The comparison of the WT and double mutant structures indi-cates that in general, all interactions are conserved except the

Fig.4. The crystal structure of AS-48G13K/L40K mutant and comparison with the WT water-soluble structure. (A) Ribbon representation of the structure of the double mutantprotomer. Mutations are shown in stick mode. (B) Stereoview of the superimposition of the double mutant (purple) and wild type (green) (PDB code 1O82) dimeric crystalstructures (mutant chain A was used as the reference) Mutations are shown in stick mode, the extra H-bond found in the mutant structure is shown in dash line. (C and D)Two different views of the superimposed structures shown in (B). Hydrogen bonds and hydrophobic contacts are shown in dash and curved lines, respectively. (E)Comparison between the three crystallized WT water-soluble structures. Superimposition of the backbones of 1O82, 1O83 and 1O84 structures shown in green, blue andpink, respectively. 1O82 and 1O83 correspond to the same crystal form but were crystallized in different conditions. 1O84 belongs to a different crystal form.

Table 4The interface of the WT and mutant dimeric structures. The buried surface area perprotomer is shown in 2. Ala-34 (protomer A) Asn-17 (protomer B) and the newlyformed Lys-13 (protomer A) Ala-34 (protomer B) hydrogen bonds are shown inblack bold numbers.

Residue No. Protomer A Protomer B

WT Mutant WT Mutant

Gly-6 2.58 2.57Pro-8 45.02 50.12 0.67Ala-9 0.49Ala-10 78.98 59.61 26.69 24.70Val-11 40.00 42.39 34.64 36.57Gly/Lys-13 2.00 32.05 0.16 10.52Thr-14 61.52 62.09 63.75 66.37Asn-17 29.75 32.08Val-18 20.06 21.89Ala-21 4.01 4.51Gly-23 0.17Trp-24 31.58 22.49 68.22 57.96Thr-27 32.00 36.44 40.84 36.21Ser-30 5.47 4.65 21.24 18.51Ile-31 38.66 37.91 46.20 43.62Thr-33 0.73 0.37Ala-34 80.65 81.12 30.38 66.94Val-35 16.08 24.66 7.84Gly-36 0.67 4.19

newly formed Lys-13-Ala-34, where hydrophobic and hydrophiliccontacts take place (Table 4 and Fig. 4C). There is a 10.9/9.8% and11.3/10.5% decrease in the solvent accessible area per protomer(A/B) in the WT and G13K/L40K mutant structures, respectively(http://www.ebi.ac.uk/pdbe/prot_int/pistart.html) (Krissinel andHenrick, 2007), which implies a 10% increase of contacts in theG13K/L40K mutant dimer (Table 4). This suggests that the mutantdimer is more stable than the wild type. To quantify the dimericcharacter of the double mutant in solution and compare it withthe WT protein, we performed gel ltration and analytical ultra-centrifugation experiments. Gel ltration experiments showedthat under the experimental conditions, the G13K/L40K mutantelutes predominantly as a single peak, while the wild type elutionprole has a peak eluting at higher volumes and a shoulder thatelutes at the same volume as the mutant (Fig. 5). This two-peakprole could represent the equilibrium between the dimer andthe monomer. The mutant is almost exclusively dimeric and thus,these data reinforce that the dimerization properties of the G13K/L40K mutant are increased compared to the wild type.

Fig.5. Gel ltration chromatography of AS-48 WT and AS-48G13K/L40K water-solublespecies. Proles are shown in green and purple, respectively. Molecular weightstandards (BioRad) are indicated with arrows. The dashed line indicates themaximum of the elution prole of the double mutant and how it matches with therst peak (shoulder) of the WT protein.

Fig.6. Dimerization properties of AS-48 by analytical ultracentrifugation (A) WT, and (B)(dots) to an ideal model (blue curve) of a single particle migrating at a given molecular wof the direct t are shown below. R.m.s. deviation values for WT and mutant data are 0

170 R. Cebrin et al. / Journal of Structural Biology 190 (2015) 162172AS-48G13K/L40K. The graphical representations show the t of the experimental dataeight. Left and right, data acquired at 17,000 and 29,000 rpm, respectively. Residuals.003 and 0.004 AU respectively, indicating the good quality of the t.

dimerization equilibrium can cause strong effects in the ability ofthe protein to interact with membranes in vivo.

demonstrate that upon insertion, AS-48 organizes itself to generatestable pores. Thus, future research would be needed to study thisissue and completely understand the molecular mechanism ofaction of this protein.

Acknowledgments

The authors would like to thank ESRF (ID14-4 beamline) syn-chrotron for the access to the facilities and help in data collection.We also thank Dr. M. Menndez and M. Gasset (InstituteRocasolano, CSIC) for help with the protein-membrane afnitycalculations. This work was funded by Grants BIO2011-28184-C02-02 to M.J.S.-B. and BFU2011-25384 to A.A. from Ministeriode Economa y Competitividad, BIPEDD-2: S2010-BMD-2457 toA.A. from Comunidad de Madrid and the Research Plan Group

the bacterial membrane periphery would permit the dissociation of the dimeric

cturIt has been proposed that the strong dipolar moment found inthe wild type inactive water-soluble dimer could drive theapproach of AS-48 to the membrane (Sanchez-Barrena et al.,2003). We have calculated the dipole moment of the G13K/L40Kmutant dimer to understand if mutations would affect this process(http://bioinfo.weizmann.ac.il/dipol/) (Felder et al., 2007).Compared with the WT, AS-48G13K/L40K dimer dipole moment is45% smaller (Table 5), suggesting that this mutant would notapproach the membranes so powerfully. The reason of the decreaseis G13K mutation, since in the context of G13K dimeric structure,L40K does not alter the dipole moment (Table 5).

4. Conclusions

The results here presented show the consequences of two pointmutations in the antibacterial activity of AS-48 against susceptiblecells. Our experimental data support that the antimicrobial func-tion of AS-48 is achieved by the electrostatically driven approachof the inactive water-soluble dimer towards the membrane, fol-lowed by the dissociation and insertion of the protein into the lipidbilayer (Fig. 7). This would lead to the destabilization of the mem-brane that causes cell death (Galvez et al., 1991). In vitro mem-brane binding assays and membrane afnity calculations,together with the high-resolution X-ray structure of AS-48G13K/L40K and studies in solution suggest the basis of the biological beha-viour of the G13K/L40K mutant protein. Firstly, G13K woulddecrease the ability of the dimeric protein to approach the bacter-ial membrane by decreasing its dipole moment. Secondly, G13KFurthermore, equilibrium sedimentation experiments showed thatunder the experimental conditions, both proteins undergo a dimer-ization equilibrium (Fig. 6). The weight-average molecular masseswere 9910 and 11,147 kDa, for WT and G13K/L40K mutant respec-tively, suggesting that the dimerization constant is higher in thecase of the mutant. Thus, taking together the crystallographic dataand the studies in solution, our data show that Lys-13 enhances thedimeric character of AS-48. This could explain the observeddecreased antimicrobial activity and supports the model in whichdimer dissociation precedes membrane association. Similar gel l-tration migratory differences were found for the dimeric mem-brane binding protein Bin2 (Sanchez-Barrena et al., 2012). In thiscase, two point mutations in the dimer interface reduced thedimeric character of the protein as observed in vitro, and thiswas enough to completely abolish membrane binding in vivo.These results evidence how changes in physiologically relevant

Table 5Dipole moment calculations of WT and mutant AS-48 structures.

Dipole moment (Debyes)

WT structure 172G13K/L40K mutant structure 96G13K mutant structure 94

R. Cebrin et al. / Journal of Strumutation strengthens the inactive and water-soluble dimer ofAS-48. Thirdly, L40K would hinder proper membrane insertion,since Lys-40 would be in contact with the hydrophobic aliphaticchains of phospholipids generating repulsions. Thus, our data sug-gest that the effect of each mutation along the different steps of themolecular mechanism of action decreases the antimicrobial char-acter of the protein. The most striking results were obtained withArthrobacter sp., a bacterium belonging to Phylum Actinobacteriawith a more hydrophobic cell wall. In this case, even the singlepoint mutations produce a detrimental effect on the antibacterialactivity, while these point mutants are still active against otherstrains. This permits to think that it would be possible to designmutants using bioinformatics tools that can target specically cer-tain strains due to their different cell wall composition.Furthermore, the presented data indicate that it would be possibleto design a protein with improved antimicrobial activity bygenerating mutants that increase the dipolar moment, shift thedimerization equilibrium to the monomeric and active proteinand show a more amphipathic surface, with more positive chargesin the Lys-rich moiety and more hydrophobicity in the hydropho-bic moiety. These data will be very relevant for the for pharmaceu-tical and food industries. Finally, our work contributes to theunderstanding of the molecular mechanism of action of thisbiotechnologically relevant protein. However, there are still someimportant issues to be determined. Based on our published mem-brane permeation studies (Galvez et al., 1991), Cruz et al. (2013)performed coarse-grained simulations and suggested that the pro-tein could form stable pores. There are no experimental data that

protein. Thirdly, amphipathic and monomeric AS-48 would insert into themembrane, establishing both electrostatic and hydrophobic interactions. Theaccumulation of AS-48 molecules on the outer leaet of the membrane woulddestabilize it causing cell permeation and ultimately, cell death.Fig.7. Diagram summarizing the mechanism of AS-48 for bacterial membraneassociation. Firstly, electrostatically driven approach of the dimeric and inactive AS-48 (surface exposed positive charges are depicted in blue, hydrophobic residues inyellow, and the strong dipole moment, with a red arrow). Secondly, the low pH atal Biology 190 (2015) 162172 171(BIO-160). M.J.S.-B. was supported by a Ramn y Cajal contractRYC-2008-03449 and R.C. was the beneciary of a Grant from theSpanish Ministry of Education.

References

Abriouel, H., Valdivia, E., Galvez, A., Maqueda, M., 2001. Inuence of physico-chemical factors on the oligomerization and biological activity of bacteriocinAS-48. Curr. Microbiol. 42, 8995.

Abriouel, H., Valdivia, E., Martinez-Bueno, M., Maqueda, M., Galvez, A., 2003. Asimple method for semi-preparative-scale production and recovery of enterocin

172 R. Cebrin et al. / Journal of Structural Biology 190 (2015) 162172AS-48 derived from Enterococcus faecalis subsp. liquefaciens A-48-32. J.Microbiol. Methods 55, 599605.

Abriouel, H., Lucas, R., Ben Omar, N., Valdivia, E., Glvez, A., 2010. Potentialapplications of the cyclic peptide enterocin AS-48 in the preservation ofvegetable foods beverages. Probiotic. Antimicrob. Proteins 2, 7789.

Ananou, S., Muoz, A., Glvez, A., Martnez-Bueno, M., Maqueda, M., Valdivia, E.,2008. Optimization of enterocin AS-48 production on a whey-based substrate.Int. Dairy J. 18, 923927.

Bhunia, A.K., Johnson, M.C., Ray, B., 1987. Direct detection of an antimicrobialpeptide of Pediococcus acidilactici in sodium dodecyl sulphatepolyacrylamidegel electrophoresis. J. Ind. Microbiol. 2, 319322.

Birnboim, H.C., Doly, J., 1979. A rapid alkaline extraction procedure for screeningrecombinant plasmid DNA. Nucleic Acids Res. 7, 15131523.

Chen, V.B., Arendall 3rd, W.B., Headd, J.J., Keedy, D.A., Immormino, R.M., Kapral, G.J.,Murray, L.W., Richardson, J.S., Richardson, D.C., 2010. MolProbity: all-atomstructure validation for macromolecular crystallography. Acta Crystallogr. DBiol. Crystallogr. 66, 1221.

Cotter, P.D., Ross, R.P., Hill, C., 2013. Bacteriocins a viable alternative toantibiotics? Nat. Rev. Microbiol. 11, 95105.

Cruz, V.L., Ramos, J., Melo, M.N., Martinez-Salazar, J., 2013. Bacteriocin AS-48binding to model membranes and pore formation as revealed by coarse-grainedsimulations. Biochim. Biophys. Acta.

Dathe, M., Nikolenko, H., Meyer, J., Beyermann, M., Bienert, M., 2001. Optimizationof the antimicrobial activity of magainin peptides by modication of charge.FEBS Lett. 501, 146150.

Diaz, M., Valdivia, E., Martinez-Bueno, M., Fernandez, M., Soler-Gonzalez, A.S.,Ramirez-Rodrigo, H., Maqueda, M., 2003. Characterization of a new operon, as-48EFGH, from the as-48 gene cluster involved in immunity to enterocin AS-48.Appl. Environ. Microbiol. 69, 12291236.

Emsley, P., Cowtan, K., 2004. Coot: model-building tools for molecular graphics.Acta Crystallogr. D Biol. Crystallogr. 60, 21262132.

Evans, P., 2006. Scaling and assessment of data quality. Acta Crystallogr. D Biol.Crystallogr. 62, 7282.

Felder, C.E., Prilusky, J., Silman, I., Sussman, J.L., 2007. A server and database fordipole moments of proteins. Nucleic Acids Res. 35, W512W521.

Field, D., Connor, P.M., Cotter, P.D., Hill, C., Ross, R.P., 2008. The generation of nisinvariants with enhanced activity against specic gram-positive pathogens. Mol.Microbiol. 69, 218230.

Field, D., Quigley, L., OConnor, P.M., Rea, M.C., Daly, K., Cotter, P.D., Hill, C., Ross, R.P.,2010. Studies with bioengineered Nisin peptides highlight the broad-spectrumpotency of Nisin V. Microb. Biotechnol. 3, 473486.

Field, D., Begley, M., OConnor, P.M., Daly, K.M., Hugenholtz, F., Cotter, P.D., Hill, C.,Ross, R.P., 2012. Bioengineered nisin A derivatives with enhanced activityagainst both Gram positive and Gram negative pathogens. PLoS ONE 7, e46884.

Friesenegger, A., Fiedler, S., Devriese, L.A., Wirth, R., 1991. Genetic transformation ofvarious species of Enterococcus by electroporation. FEMS Microbiol. Lett. 63,323327.

Galvez, A., Maqueda, M., Valdivia, E., Quesada, A., Montoya, E., 1986.Characterization and partial purication of a broad spectrum antibiotic AS-48produced by Streptococcus faecalis. Can. J. Microbiol. 32, 765771.

Galvez, A., Maqueda, M., Martinez-Bueno, M., Valdivia, E., 1991. Permeation ofbacterial cells, permeation of cytoplasmic and articial membrane vesicles, andchannel formation on lipid bilayers by peptide antibiotic AS-48. J. Bacteriol. 173,886892.

Gasset, M., Martinez del Pozo, A., Onaderra, M., Gavilanes, J.G., 1989. Study of theinteraction between the antitumour protein alpha-sarcin and phospholipidvesicles. Biochem. J. 258, 569575.

Gill, S.C., von Hippel, P.H., 1989. Calculation of protein extinction coefcients fromamino acid sequence data. Anal. Biochem. 182, 319326.

Gonzalez, C., Langdon, G.M., Bruix, M., Galvez, A., Valdivia, E., Maqueda, M., Rico, M.,2000. Bacteriocin AS-48, a microbial cyclic polypeptide structurally andfunctionally related to mammalian NK-lysin. Proc. Natl. Acad. Sci. U.S.A. 97,1122111226.

Kawulka, K.E., Sprules, T., Diaper, C.M., Whittal, R.M., McKay, R.T., Mercier, P., Zuber,P., Vederas, J.C., 2004. Structure of subtilosin A, a cyclic antimicrobial peptidefrom Bacillus subtilis with unusual sulfur to alpha-carbon cross-links: formationand reduction of alpha-thio-alpha-amino acid derivatives. Biochemistry 43,33853395.

Krissinel, E., Henrick, K., 2007. Inference of macromolecular assemblies fromcrystalline state. J. Mol. Biol. 372, 774797.

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of thehead of bacteriophage T4. Nature 227, 680685.

Leslie, A.G., 2006. The integration of macromolecular diffraction data. ActaCrystallogr. D Biol. Crystallogr. 62, 4857.

Maqueda, M., Galvez, A., Bueno, M.M., Sanchez-Barrena, M.J., Gonzalez, C., Albert, A.,Rico, M., Valdivia, E., 2004. Peptide AS-48: prototype of a new class of cyclicbacteriocins. Curr. Protein Pept. Sci. 5, 399416.

Maqueda, M., Sanchez-Hidalgo, M., Fernandez, M., Montalban-Lopez, M., Valdivia,E., Martinez-Bueno, M., 2008. Genetic features of circular bacteriocins producedby Gram-positive bacteria. FEMS Microbiol. Rev. 32, 222.

Martinez-Bueno, M., Maqueda, M., Galvez, A., Samyn, B., Van Beeumen, J., Coyette, J.,Valdivia, E., 1994. Determination of the gene sequence and the molecularstructure of the enterococcal peptide antibiotic AS-48. J. Bacteriol. 176, 6334

6339.Martin-Visscher, L.A., van Belkum, M.J., Garneau-Tsodikova, S., Whittal, R.M., Zheng,J., McMullen, L.M., Vederas, J.C., 2008. Isolation and characterization ofcarnocyclin a, a novel circular bacteriocin produced by Carnobacteriummaltaromaticum UAL307. Appl. Environ. Microbiol. 74, 47564763.

Martin-Visscher, L.A., Gong, X., Duszyk, M., Vederas, J.C., 2009. The three-dimensional structure of carnocyclin A reveals that many circular bacteriocinsshare a common structural motif. J. Biol. Chem. 284, 2867428681.

Martin-Visscher, L.A., van Belkum, M.J., Vederas, J.C., 2011. Class IIc or circularbacteriocins. In: Drider, D., Rebuffat, S. (Eds.), Prokaryotic antimicrobialpeptides. From genes to applications. Springer, p. 213.

McCoy, A.J., Grosse-Kunstleve, R.W., Adams, P.D., Winn, M.D., Storoni, L.C., Read, R.J.,2007. Phaser crystallographic software. J. Appl. Crystallogr. 40, 658674.

McNicholas, S., Potterton, E., Wilson, K.S., Noble, M.E., 2011. Presenting yourstructures: the CCP4mg molecular-graphics software. Acta Crystallogr. D Biol.Crystallogr. 67, 386394.

Molloy, E.M., Field, D., Pm, O.C., Cotter, P.D., Hill, C., Ross, R.P., 2013. Saturationmutagenesis of lysine 12 leads to the identication of derivatives of nisin A withenhanced antimicrobial activity. PLoS ONE 8, e58530.

Montalban-Lopez, M., Sanchez-Hidalgo, M., Valdivia, E., Martinez-Bueno, M.,Maqueda, M., 2011. Are bacteriocins underexploited? Novel applications forold antimicrobials. Curr. Pharm. Biotechnol. 12, 12051220.

Montalban-Lopez, M., Sanchez-Hidalgo, M., Cebrian, R., Maqueda, M., 2012.Discovering the bacterial circular proteins: bacteriocins, cyanobactins, andpilins. J. Biol. Chem. 287, 2700727013.

Murshudov, G.N., Vagin, A.A., Dodson, E.J., 1997. Renement of macromolecularstructures by the maximum-likelihood method. Acta Crystallogr. D Biol.Crystallogr. 53, 240255.

OSullivan, D.J., Klaenhammer, T.R., 1993. Rapid mini-prep isolation of high-qualityplasmid DNA from Lactococcus and Lactobacillus spp. Appl. Environ. Microbiol.59, 27302733.

Potter, A., Ceotto, H., Coelho, M.L., Guimaraes, A.J., Bastos Mdo, C., 2014. The genecluster of aureocyclicin 4185: the rst cyclic bacteriocin of Staphylococcusaureus. Microbiology 160, 917928.

Rink, R., Wierenga, J., Kuipers, A., Kluskens, L.D., Driessen, A.J., Kuipers, O.P., Moll,G.N., 2007. Dissection and modulation of the four distinct activities of nisin bymutagenesis of rings A and B and by C-terminal truncation. Appl. Environ.Microbiol. 73, 58095816.

Rollema, H.S., Kuipers, O.P., Both, P., de Vos, W.M., Siezen, R.J., 1995. Improvementof solubility and stability of the antimicrobial peptide nisin by proteinengineering. Appl. Environ. Microbiol. 61, 28732878.

Rouse, S., Field, D., Daly, K.M., OConnor, P.M., Cotter, P.D., Hill, C., Ross, R.P., 2012.Bioengineered nisin derivatives with enhanced activity in complex matrices.Microb. Biotechnol. 5, 501508.

Samyn, B., Martinez-Bueno, M., Devreese, B., Maqueda, M., Galvez, A., Valdivia, E.,Coyette, J., Van Beeumen, J., 1994. The cyclic structure of the enterococcalpeptide antibiotic AS-48. FEBS Lett. 352, 8790.

Sanchez-Barrena, M.J., Martinez-Ripoll, M., Galvez, A., Valdivia, E., Maqueda, M.,Cruz, V., Albert, A., 2003. Structure of bacteriocin AS-48: from soluble state tomembrane bound state. J. Mol. Biol. 334, 541549.

Sanchez-Barrena, M.J., Vallis, Y., Clatworthy, M.R., Doherty, G.J., Veprintsev, D.B.,Evans, P.R., McMahon, H.T., 2012. Bin2 is a membrane sculpting N-BAR proteinthat inuences leucocyte podosomes, motility and phagocytosis. PLoS ONE 7,e52401.

Sanchez-Hidalgo, M., Martinez-Bueno, M., Fernandez-Escamilla, A.M., Valdivia, E.,Serrano, L., Maqueda, M., 2008. Effect of replacing glutamic residues upon thebiological activity and stability of the circular enterocin AS-48. J. Antimicrob.Chemother. 61, 12561265.

Sanchez-Hidalgo, M., Fernandez-Escamilla, A.M., Martinez-Bueno, M., Valdivia, E.,Serrano, L., Maqueda, M., 2010. Conformational stability and activity of circularEnterocin AS-48 derivatives. Protein Pept. Lett. 17, 708714.

Sanchez-Hidalgo, M., Montalban-Lopez, M., Cebrian, R., Valdivia, E., Martinez-Bueno, M., Maqueda, M., 2011. AS-48 bacteriocin: close to perfection. Cell. Mol.Life Sci. 68, 28452857.

Scholz, R., Vater, J., Budiharjo, A., Wang, Z., He, Y., Dietel, K., Schwecke, T., Herfort, S.,Lasch, P., Borriss, R., 2014. Amylocyclicin, a novel circular bacteriocin producedby Bacillus amyloliquefaciens FZB42. J. Bacteriol. 196, 18421852.

van Belkum, M.J., Martin-Visscher, L.A., Vederas, J.C., 2011. Structure and genetics ofcircular bacteriocins. Trends Microbiol. 19, 411418.

van Loosdrecht, M.C., Lyklema, J., Norde, W., Schraa, G., Zehnder, A.J., 1987. The roleof bacterial cell wall hydrophobicity in adhesion. Appl. Environ. Microbiol. 53,18931897.

Winn, M.D., Ballard, C.C., Cowtan, K.D., Dodson, E.J., Emsley, P., Evans, P.R., Keegan,R.M., Krissinel, E.B., Leslie, A.G., McCoy, A., McNicholas, S.J., Murshudov, G.N.,Pannu, N.S., Potterton, E.A., Powell, H.R., Read, R.J., Vagin, A., Wilson, K.S., 2011.Overview of the CCP4 suite and current developments. Acta Crystallogr. D Biol.Crystallogr. 67, 235242.

Wirth, R., An, F.Y., Clewell, D.B., 1986. Highly efcient protoplast transformationsystem for Streptococcus faecalis and a new Escherichia coli S. faecalis shuttlevector. J. Bacteriol. 165, 831836.

Yuan, J., Zhang, Z.Z., Chen, X.Z., Yang, W., Huan, L.D., 2004. Site-directedmutagenesis of the hinge region of nisinZ and properties of nisinZ mutants.Appl. Microbiol. Biotechnol. 64, 806815.

The bacteriocin AS-48 requires dimer dissociation followed by hydrophobic interactions with the membrane for antibacterial activity1 Introduction2 Experimental procedures2.1 Bacterial strains and culture conditions2.2 Plasmids and DNA manipulations2.3 Mutagenesis procedure and pAM401-81G13K/L40K plasmid construction2.4 AS-48 and engineered derivatives purification2.5 Circular dichroism2.6 Biological activity assays and determination of minimal inhibitory concentration2.7 Liposome cosedimentation assays2.8 Membrane affinity calculations2.9 Crystallization, diffraction data collection and structure solution2.10 Gel filtration chromatography2.11 Analytical ultracentrifugation

3 Results and discussion3.1 Biological characterization of the AS-48G13K/L40K double mutant3.2 The interaction of AS-48 with membranes3.3 The water-soluble form of AS-48G13K/L40K mutant

4 ConclusionsAcknowledgmentsReferences