1 ryk, a catalytically inactive receptor tyrosine kinase, associates
TRANSCRIPT
![Page 1: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/1.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
1
RYK, a catalytically inactive receptor tyrosine kinase, associates with EphB2 and
EphB3, but does not interact with AF-6.
Elisabeth Trivier, Trivadi S. Ganesan
Cancer Research UK, Molecular Oncology laboratories, Weatherall Institute of
Molecular Medicine, John Radcliffe Hospital, Headington, Oxford OX3 9DS, UK
Phone : (44) 01865 222 458
Fax : (44) 01865 222 431
e-mail : [email protected]
Running title : RYK’s interaction with EphB2, EphB3 and AF-6
Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on April 15, 2002 as Manuscript M202486200 by guest on A
pril 12, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 2: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/2.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
2
SUMMARY
RYK1 is an atypical orphan receptor tyrosine kinase, which lacks detectable kinase
activity. Nevertheless, using a chimeric receptor approach, we previously found that
RYK can signal via the MAPK pathway. Recently, it has been shown that murine Ryk
can bind to and be phosphorylated by the ephrin receptors EphB2 and EphB3. In this
study, we show that human RYK associates with EphB2 and EphB3 but is not
phosphorylated by them. This association requires both the extracellular and
cytoplasmic domains of RYK, and is not dependent on activation of the Eph receptors.
It was also previously shown that AF-6 (afadin), a PDZ domain containing protein,
associates with murine Ryk. We show here that AF-6 does not bind to human RYK in
vitro or in vivo. This suggests that there are significant functional differences between
human and murine RYK. Further studies are required to determine if RYK modulates
the signaling of EphB2 and EphB3.
1 RYK, Receptor like Tyrosine Kinase
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 3: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/3.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
3
INTRODUCTION
RYK is an atypical orphan receptor tyrosine kinase which differs from other
members of this family at a number of conserved residues in the activation and
nucleotide binding domains, and lacks detectable catalytic activity (1-4). The extra-
cellular domain of RYK is quite short when compared to other RTKs2, being only 183
amino acids long. It appears to be largely devoid of features characteristic of other
RTKs, such as immunoglobulin-like domains (5), fibronectin type III repeats (6), or
cysteine-rich domains (7). However, it contains two leucine-rich motifs, which are
usually implicated in highly specific protein/protein interactions (8,9) as well as in cell
adhesion (10). There is also a tetrabasic protease cleavage site (KRRK) flanked by
two cysteine residues in the extracellular domain, which is predicted to give rise to two
fragments. Another interesting feature in the extracellular domain of RYK is the
presence of a WIF (Wnt inhibitory factor) module (11), suggesting the possibility that
RYK may bind to one of the members of the Wnt family of proteins.
The ability of RYK to signal downstream was investigated using a chimeric
receptor approach (2). This conclusively demonstrated that the catalytic domain of
RYK is inactive and that the amino acid alterations in the activation domain contribute
to the lack of catalytic function. However, a tyrosine-phosphorylated 75kD protein was
co-immunoprecipitated with the receptor, independently of stimulation, and activation
of the MAPK3 pathway was observed following stimulation of the receptor.
Interestingly, when the invariant lysine in sub domain II of the catalytic domain was
mutated to alanine (K334A), abolishing any existing kinase activity, the receptor failed
2 RTK, Receptor Tyrosine Kinase
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 4: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/4.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
4
to activate the MAPK pathway and to bind and/or phosphorylate the 75 kDa protein.
Further, RYK is overexpressed in ovarian tumours, and this correlates adversely with
survival (12).
The exact function of RYK is unknown and its ligand has not been identified. A
mouse model, where Ryk was homozygously deleted by homologous recombination,
revealed an unusual, completely penetrant phenotype (13). The mice were small,
compared to wild type, and died within a week due to cleft palate. Such a phenotype
has been found in other knockout mice, including those lacking members of the
Ephrin receptor family (14). It was recently shown that, although Ryk cannot auto-
phosphorylate, it can associate and be phosphorylated by two members of the Eph
family of receptors : EphB2 and EphB3 (13). The Ephrin receptor family, which
consists of 14 members, has been shown to mediate contact-dependent cell
interactions that regulate the repulsion and adhesion mechanisms involved in the cell
guidance and assembly of multicellular structures (15,16). They are important in the
development of a range of vertebrate species, in the formation of blood vessels,
axonal guidance and metastasis of transformed cells (15,17). Yeast two-hybrid
analysis, using the cytoplasmic domain of murine Ryk as a probe, has identified an
interaction with AF-6, a PDZ domain containing protein (13). This interaction involved
the PDZ domain of AF-6 and the C-terminal region of Ryk, especially the critical C-
terminal valine residue. This valine residue is completely conserved among RYK
homologues from Drosophila to human. AF-6 is a scaffold protein found at sites of
cell-cell contact, and a target of the Ras family of proteins (18,19). Interestingly, a
3 MAPK, Mitogen Activated Protein Kinase
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 5: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/5.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
5
subset of activated Eph receptors, including EphB2, EphB3 and EphA7, also bind to
AF-6 (20,21).
The purpose of this study was to investigate further the interaction between
RYK and the Eph receptors, and RYK and AF-6.
EXPERIMENTAL PROCEDURES
Plasmids. The following plasmids were received as gifts : Myc-AF-6, Kozo Kaibuchi
(Nara Institute of Science and Technology, Japan) (19), HA-EphB3 and HA-
EphB3K665R, Steven Stacker (Ludwig Institute for Cancer Research, Australia) (21),
EphB2, Tony Pawson (Samuel Lunenfeld Research Institute Toronto, Canada)
(22,23). The TrkA:RYK chimeric construct has been previously described (2). The
RYK.V5 plasmid was constructed by cloning RYK (acc. nº NM_002958) in pTracer
(Invitrogen) in frame with the V5 tag. A NotI site was created at the 3’ end of the cDNA
and the TGA stop codon was mutated to TGG, by PCR using the primer
TGAGCGGCCGCGAGAGGAGCCAGACGTAGG. The RYKEC construct was made by
cloning an EcoRI-HindIII fragment (nucleotides 1 to 1201) (acc. nº NM_002958) in
frame with GFP in pEGFP vector (Clontech).
Growth factor and antibodies. The recombinant human NGF4 was purchased from
R&D Systems. The N-terminal TrkA-specific monoclonal antibody (MAb) 5C3 was a
gift from U. Saragovi, the N-terminal anti-mouse RYK antibody RYK3 was a gift from
Steven Stacker (Ludwig Institute for Cancer Research, Australia) (24), the anti-human
RYK polyclonal antibody 15.2 was raised against the C-terminal region of RYK (25).
4 NGF, Nerve Growth Factor
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 6: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/6.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
6
The following antibodies are commercially available : AF-6 (Transduction
laboratories), EphB2 (Santa Cruz Biotechnology), Trk N-terminal (Zymed), HA tag
(Roche), V5 tag (Invitrogen), His tag (Novagen), GFP mouse monoclonal (Clontech),
myc (Santa Cruz Biotechnology), antiphosphotyrosine 4G10 (Upstate biotechnology).
Transfection, immunoprecipitation, and immunoblotting. HEK293T cells were
transfected using Effectene (Qiagen) according to the manufacturer’s instructions.
For double transfections, RYK.V5 and HA.EphB3 or EphB2 were used in the ratio 4:1.
Cells were treated with 1mM sodium butyrate, a non-specific transcriptional inducer,
5 hours after transfection. Twenty four to 48 hours after transfection, cells were lysed
on ice for 15 min in lysis buffer (1% TritonX-100, 0.5% Nonidet P-40, 150 mM NaCl,
50 mM Tris-HCl pH 7.4, 1 mM EDTA, 0.5 mM EGTA) containing a protease inhibitor
cocktail (Roche) and a phosphatase inhibitor cocktail (Calbiochem). Alternatively,
RIPA buffer (1% Nonidet P-40, 1% sodium deoycholate, 0.1% SDS, 150 mM NaCl, 50
mM Tris-HCl pH 7.4, 1 mM EDTA) was used to lyse cells. Insoluble material was
removed by centrifugation for 20 min at 13,000 rpm at 4°C. Cell lysates were
incubated with antibodies and protein A or G agarose beads at 4ºC. All the
immunoprecipitations were washed twice in lysis buffer containing 1M NaCl, and
once in unsupplemented lysis buffer. For immunoblotting, the immunoprecipitates
were resolved by SDS-polyacrylamide gel electrophoresis (PAGE) according to
standard protocols and then transferred onto nylon membranes. Antibodies were
used according to manufacturer's conditions. The 15.2 and RYK3 antibodies were
used 1/500 in 1% milk and 0.2% Tween 20 for blotting.
For the induction studies with NGF, cells were washed once with PBSA, and then
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 7: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/7.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
7
incubated for 16h in serum-free medium, 30 hours after transfection. The quiescent
cells were stimulated with recombinant human NGF (100ng/ml) for different time
intervals (0, 5, 15, 30 or 60 min.) before being lysed.
Purification of the His-tagged catalytic domain of RYK. The catalytic domain of RYK
(nucleotide 1019 to 2138, acc. nº NM_002958) was generated by PCR using the
following primers : 5’TTAACTGCAGAGAAGTGTCACTCTTTTGGAG3’, and M13 reverse
primer from pBluescript. The cDNA was cloned as a PstI/EcoRI fragment in a
baculovirus vector (pBlueBacHis2 , Invitrogen), in frame with an His-tag on the N-
terminal end, and expressed in SF9 cells. Cells were infected with an MOI of 10,
grown at 27ºC and lysed after 4 days in : 20 mM Tris pH8, 0.5M NaCl, 1% Triton, 1%
Tween, 0.5% NP40, protease inhibitors (pepstatin, leupeptin, aprotinin, trypsin
inhibitor, PMSF). After centrifugation at 14000 rpm for 30 min., the protein was bound
on a Cobalt sepharose column (Talon, Clontech) for 1 hour at 4ºC, in lysis buffer
containing 10mM imidazole. The resin was washed thoroughly with lysis buffer
containing 10mM imidazole, and the protein was eluted in 20mM Tris pH7.5, 0.5M
NaCl, 50mM imidazole. The protein was concentrated using a Centriplus YM-10
(Amicon), dialysed against a 20mM Tris pH8 solution, and stored at -70ºC in 10%
glycerol.
In vitro kinase assay. HA.EphB3 was transiently expressed in HEK 293T cells and
immunoprecipitated using an anti-HA antibody. 1µg of purified RYK catalytic domain
was bound to protein G agarose beads using an anti-His antibody. The
immunoprecipitates were washed twice in lysis buffer containing 1M NaCl, and twice
in kinase buffer (30mM Tris pH7.5, 20mM MgCl2, 20mM MnCl2, 1mg/ml BSA). The
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 8: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/8.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
8
proteins bound to the agarose beads were resuspended in 100 µl of kinase buffer
containing 200 µM ATP and incubated at 30ºC for 45 min. They were washed in
kinase buffer and resuspended in sample buffer. The proteins were resolved by SDS
PAGE, blotted and phosphorylation was detected using the anti-phosphotyrosine
antibody 4G10.
For the kinase assay using full length RYK as a substrate, HA.EphB3, myc.AF-6 and
RYK.V5 were transiently expressed in HEK 293T cells and immunoprecipitated using
an anti-HA tag, anti-AF-6 and anti V5 antibodies respectively. The immunoprecipitates
were washed twice in lysis buffer containing 1M NaCl, and twice in kinase buffer.
HA.EphB3 was resuspended with myc.AF-6 or RYK.V5 in 100 µl of kinase buffer
containing 200 µM ATP and incubated at 30ºC for 45 min. They were washed in
kinase buffer and resuspended in sample buffer. The proteins were resolved by SDS
PAGE, blotted and phosphorylation was detected using the anti-phosphotyrosine
antibody 4G10.
Binding Assay. A myc-tagged AF-6 construct was transfected in HEK 293T cells and
immunoprecipitated using an anti-myc antibody. Cell lysate from untransfected HEK
293T cells was also immunoprecipitated with the anti-myc antibody. The protein G
agarose beads were resuspended in PBSA and 1µg of the purified RYK catalytic
domain, RYK.cat. was added. After one hour incubation at 4ºC, the beads were
washed in lysis buffer, and resuspended in sample buffer, before being resolved by
SDS PAGE and blotted.
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 9: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/9.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
9
RESULTS
Expression of RYK
Transfection of HEK 293T cells with a C-terminal V5-tagged RYK, followed by
immunoprecipitation by an anti-V5 antibody, and immunoblotting with the same
antibody, identified two major signals : a set of bands at around 80 kDa (comprising 3
bands of 70, 75 and 80 kDa) and another at 45 kDa. The 45 kDa band was detected
by the anti-V5 (Fig. 1A) and 15.2 antibodies (a polyclonal antibody directed against a
C-terminal epitope from RYK) (Fig. 1C). The RYK3 antibody, directed against the
extracellular domain of the receptor (24), only detected the high molecular weight
bands of 70, 75 and 80 kDa (Fig. 1B). The 45 kDa form must therefore lack the part of
the extracellular domain containing the RYK3 epitope. It is probable that the receptor
is cleaved at the tetrabasic protease cleavage site (KRRK), which would remove the
first 192 amino acids, resulting in a predicted protein of 41 kDa. Surprisingly, whereas
the anti-V5 antibody detects all the isoforms, the 15.2 antibody does not recognize the
75 and 80 kDa bands.
RYK is unable to autophosphorylate
RYK has not been shown to have catalytic activity, in vitro on a peptide
substrate, using the whole protein or the catalytic domain on its own produced in
bacteria (1,4), or in vivo using a chimeric receptor approach (2). We undertook to
study the ability of RYK to autophosphorylate using a biochemical approach. We
cloned the catalytic domain in a baculoviral vector, expressed it in SF9 insect cells and
purified it under non-denaturing conditions. An in vitro kinase assay using the purified
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 10: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/10.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
10
protein showed that the catalytic domain of RYK is unable to autophosphorylate (Fig.
2). As a positive control, EphB3 was phosphorylated in the presence of ATP.
RYK associates with EphB2 and EphB3 but is not phosphorylated
We transfected HEK 293T cells with RYK.V5 together with HA.EphB3 or a
kinase inactive mutant of EphB3 (EphB3K665R) (21). Upon immunoprecipitation of
RYK by the anti-V5 antibody, both wild type EphB3 and EphB3K665R were detected
(Fig. 3A,B,C). This shows that EphB3 and RYK interact, and that this association is not
dependent on activation and phosphorylation of the Eph receptor. However, although
the binding with RYK was demonstrated under stringent conditions using RIPA buffer
(data not shown), there was no phosphorylation of RYK (Fig. 3D) when it is co-
expressed with EphB3. To further evaluate the ability of EphB3 to phosphorylate RYK,
we performed an in vitro kinase assay on immunoprecipitated proteins. HEK 293T
cells were transfected with HA.EphB3, RYK.V5 or myc.AF-6, and these proteins were
immunoprecipitated using the appropriate antibodies. An in vitro kinase assay was
performed using immunoprecipitated EphB3 and RYK or AF-6, and their
phosphorylation was detected with 4G10 antibody. EphB3 failed to phosphorylate full
length RYK (Fig. 4A,B,D), while the positive control AF-6 was phosphorylated (Fig.
4A,C,D). Furthermore, EphB3 was unable to phosphorylate the catalytic domain of
RYK in an in vitro kinase assay (data not shown).
A converse experiment where we co-expressed EphB3 and RYK in HEK 293T
cells, and immunoprecipitated EphB3 (Fig. 5) showed the same result. Interestingly,
only the 80 kDa form of RYK associated with EphB3, suggesting an essential role of
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 11: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/11.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
11
the extracellular domain of RYK for this interaction.
We also investigated the interaction between RYK and EphB2 (Fig. 6). When
both receptors were expressed transiently in HEK 293T cells, and EphB2 was
immunoprecipitated, only the 80 kDa form of RYK was detected (Fig. 6A,B,C),
although it is possible that the 45 kDa band was not detected because of unspecific
bands. A phosphotyrosine blot (Fig. 6D) showed that EphB2 was activated but did not
phosphorylate RYK. This suggests that, similar to EphB3, the association between
RYK and EphB2 is dependent on the extracellular domain of RYK, and does not lead
to the phosphorylation of RYK.
In order to investigate further the association between RYK and EphB3, and
assess whether the extracellular domain of RYK is required for the interaction to take
place, we co-expressed EphB3 and a TrkA:RYK chimeric receptor, or EphB3 and TrkA
as a negative control. The TrkA:RYK chimeric receptor contains the extracellular
domain of TrkA, the NGF receptor, and the transmembrane and intracellular domains
of RYK (2). When expressed, TrkA is a 120 kDa protein, and TrkA:RYK is 140 kDa or
120 kDa depending on its state of glycosylation. The chimeric receptor, lacking the
extracellular domain of RYK, did not associate with EphB3 (Fig. 7).
We then wanted to assess if the extracellular domain of RYK on its own was
able to bind EphB3. We constructed a GFP-tagged cDNA (RYKEC) containing the
extracellular, transmembrane and juxtamembrane domains of RYK, and co-
expressed it with EphB3 in HEK 293T cells (Fig. 8). The predicted size of RYKEC
protein, together with GFP (30 kDa), is 70 kDa. On transfection, the protein migrated at
85 kDa on SDS-PAGE, probably due to glycosylation. When EphB3 was
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 12: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/12.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
12
immunoprecipitated, RYKEC did not associate with it, suggesting that the whole
receptor is required for the interaction between RYK and EphB3.
RYK does not associate with AF-6
The C-terminal end of RYK possesses a consensus sequence for the binding
of a PDZ domain (Fig. 9). The C-terminal tyrosine and valine residues are completely
conserved. As RYK is devoid of catalytic activity and PDZ domains do not bind to
phosphorylated amino acids (26-28), it is possible that RYK may signal via a PDZ
domain containing protein. Of several PDZ domain containing proteins, only AF-6 has
been shown to bind RTKs such as EphB2 and EphB3. In the light of previous results
(13), we wished to evaluate whether AF-6 bound to RYK.
When the TrkA:RYK chimeric receptor, which contains the entire cytoplasmic
domain of RYK, and AF-6 were co-expressed in HEK 293T cells, they did not
associate, whether AF-6 (Fig. 10A,B) or the chimeric receptor (Fig. 10C,D) was
immunoprecipitated. EphB3, which was used as a positive control for the interaction,
was immunoprecipitated with AF-6 (Fig. 10E,F). The possibility that AF-6 may bind to
RYK when the latter is stimulated was excluded when no association was observed
after stimulation of TrkA:RYK with NGF (data not shown). Transfection with full length
untagged RYK could not be used in these experiments as the 15.2 antibody has low
affinity for immunoprecipitation.
To further verify if there is direct interaction between the proteins, we used the
purified His-tagged catalytic domain of RYK. AF-6 was immunoprecipitated from
transfected HEK 293T cells and mixed with RYK.cat under physiological conditions.
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 13: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/13.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
13
Subsequently, after washing the agarose beads, proteins were resolved by SDS
PAGE gel and blotted. As shown (Fig. 11), AF-6 does not bind in the presence of
excess amount of the catalytic domain of RYK.
DISCUSSION
RYK is a receptor tyrosine kinase which belongs to a small family of individually
distinct receptors that are devoid of catalytic activity (29). The mechanism of signaling
by these receptors is best understood for erbB3 (30).
We have observed several forms of the RYK protein in transfected cells, with
different molecular weight : 45, 70, 75 and 80 kDa. The three high molecular weight
bands are full length receptors, since they are recognized by the V5 and RYK3,
specific to the extracellular domain, antibodies. The three different sizes could be due
to differences in the glycosylation status of the protein, although other post-
translational modifications could occur since the 75 and 80 kDa bands are not
detected by the 15.2 antibody. The epitope against which this antibody is directed is a
17mer peptide located at position 548-564 of the RYK protein. It contains a cysteine
that could be converted to formylglycine; this modification occurs in sulfatases at a
late stage of co-translational protein translocation into the endoplasmic reticulum
(31). There are also two glutamate residues in the peptide that could be converted to
carboxyglutamate by a carboxylase (32). If such post-translational modifications occur
in the RYK protein, the modified forms of RYK may not be recognized by the 15.2
antibody. The 45 kDa band is not detected by the RYK3 antibody directed against the
extracellular domain, and must be a truncated form of the receptor, presumably
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 14: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/14.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
14
resulting from the cleavage of the extracellular domain. This cleavage is very likely to
take place at the tetrabasic protease cleavage site (KRRK). Ectodomain cleavage
occurs frequently among cell surface transmembrane proteins, including receptor
tyrosine kinases such as ErbB4 (33), CSF-1R5 (34), c-kit (35) (36), Met (37), or TrkA
(38). It seems to be a general mechanism to modulate receptors, by down regulating
ligand-induced signaling (39,40). Since only the full length RYK, and not the 45kDa
form, co-immunoprecipitates with EphB3 and EphB2, it seems likely that, like with
other RTKs, the ectodomain cleavage of RYK regulates the receptor, either by
preventing binding of the unknown ligand or the binding of other receptors.
The heterodimerization of RTKs belonging to two different families is unusual,
but it has been reported. The EGFR6 and PDGFR7 have been shown to
heterodimerize independently of receptor stimulation, and transactivation of EGFR
was observed after stimulation with PDGF8. EGFR transactivation by PDGF did not
depend on PDGFR kinase activity, but phosphorylation of one of the receptors, or of a
protein that links the receptors, by a Src kinase was required to maintain heterodimer
formation (41). The interaction between RYK and the Eph receptors is unusual
because RYK does not get phosphorylated and therefore may have a role different
from that of analogous interactions involving typical RTKs. RYK could act as an
inhibitor of EphB2 and EphB3, by preventing homodimerization of these receptors, but
data provided by knock out mice for these receptors seem to suggest that RYK and
these two Eph receptors may co-operate in vivo. RYK is required in normal
5 CSF, Colony Stimulating Factor6 EGFR, Epidermal Growth Factor Receptor7 PDGFR, Platelet Derived Growth Factor Receptor
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 15: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/15.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
15
development and morphogenesis of craniofacial structures and the limbs (13).
Neonatal mice doubly deficient in EphB2 and EphB3 phenocopy RYK-deficient mice in
terms of cleft palate, but also show commissural axon defects (14), which are
reminiscent of the Drosophila drl phenotype (42-45) (Drl9 is one the RYK homologous
genes in Drosophila). RYK could cooperate with the Eph receptors in several ways.
EphB2 and EphB3 are able to bind to several ephrin B ligands, and RYK, when
heterodimerized with these receptors, could modulate their affinity to a particular
ligand. This has been observed in the EGFR family of RTKs where, for instance,
neuregulin-α can bind to erbB3 but does not activate the receptor when it is co-
expressed with EGFR (46,47). RYK could also modulate signaling downstream of the
Eph receptors by recruiting specific cytoplasmic proteins.
Our results indicate that both the intracellular and extracellular domains of RYK
are required for the interaction with EphB3. It has been observed, in the erbB family of
RTKs, that stimulation of the isolated extracellular domains of the receptors leads to
homo-oligomerization, but not hetero-oligomerization (48). This suggests that regions
outside the extracellular domain are required for heteromeric interactions, as it is the
case for RYK and the Eph receptors.
We have demonstrated in this study that the association between RYK and
EphB2 or EphB3 does not result in the phosphorylation of RYK. However, a previous
study (13) showed that, when the receptors are co-expressed, murine Ryk associates
with and is phosphorylated by EphB2 and EphB3. In both studies, co-transfections
were performed in HEK 293T cells with the same EphB3 cDNA construct, but we used
8 PDGF, Platelet Derived Growth Factor
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 16: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/16.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
16
a human RYK cDNA, whereas the authors used the murine homologue, Ryk. The
ability of EphB3 to phosphorylate RYK could not be detected, either in vivo or in vitro.
The identity between the human and murine cDNAs is very high (93%), but our results
indicate that they do not signal in the same way. The species-dependent
phosphorylation of a substrate by a kinase has been observed in the case of p53 (49).
Murine p53 can be phosphorylated by MAPK whereas human p53 is not, suggesting
species-specific differences in the modification, and therefore possibly the regulation
of the protein.
Further, using a murine Ryk homologue, the authors of a previous study (13)
were able to show that AF-6, a PDZ domain containing protein, could interact with the
receptor via its PDZ domain, and that the C-terminal valine of Ryk was essential for
this interaction. AF-6 is a Ras effector located at sites of cell-cell junctions (18,19),
and has been shown to bind to EphB2 and EphB3 (20,21). However, we were unable
to show any interaction between the cytoplasmic domain of human RYK and AF-6.
The co-transfection experiments, performed using the TrkA:RYK chimera in order to
be able to immunoprecipitate RYK, did not correlate with the data obtained using
murine Ryk, although only the extracellular domain of RYK was missing from the
receptor. The observed differences in the data can only be explained as due to
species specificity. The C-terminal part of the human and mouse receptors, which is
the AF-6 binding peptide, are identical, but another motif, present only in the mouse
homologue, could also be required for the interaction. AF-6 binds to EphB2 and
EphB3 only if these receptors are activated and phosphorylated (20); the C-terminal
9 Drl, Derailed
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 17: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/17.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
17
motif of the receptors is therefore not the only feature needed for the interaction with
AF-6.
In summary, our results suggest that the human homologue of RYK, although it
binds to EphB2 and EphB3, is not phosphorylated by these receptors. Further studies
exploring the mechanism by which RYK may modulate signaling by EphB2 and
EphB3 are required.
ACKNOWLEDGMENTS
We would like to thank Dr S. Stacker, Dr K. Kaibuchi, Dr T. Pawson and Dr U. Saragovi
for kindly providing us with plasmids and antibodies. This work was supported by
Cancer Research UK.
REFERENCES
1. Hovens, C. M., Stacker, S. A., Andres, A. C., Harpur, A. G., Ziemiecki, A., and
Wilks, A. F. (1992) Proc Natl Acad Sci U S A 89, 11818-11822
2. Katso, R. M., Russell, R. B., and Ganesan, T. S. (1999) Mol Cell Biol 19, 6427-
6440
3. Wang, X. C., Katso, R., Butler, R., Hanby, A. M., Poulsom, R., Jones, T., Sheer,
D., and Ganesan, T. S. (1996) Mol Med 2, 189-203
4. Tamagnone, L., Partanen, J., Armstrong, E., Lasota, J., Ohgami, K., Tazunoki,
T., LaForgia, S., Huebner, K., and Alitalo, K. (1993) Oncogene 8, 2009-2014
5. Williams, A., and Barclay, A. (1988) Annu Rev Immunol 6, 381-405
6. Petersen, T., Thogersen, H., Skorstengaard, K., Vibe-Pedersen, K., Sahl, P.,
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 18: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/18.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
18
Sottrup-Jensen, L., and Magnusson, S. (1983) Proc Natl Acad Sci U S A 80,
137-141
7. Ullrich, A., Coussens, L., Hayflick, J., Dull, T., Gray, A., Tam, A., Lee, J., Yarden,
Y., Libermann, T., and Schlessinger, J. (1984) Nature 309, 418-425
8. Schneider, R., Schneider-Scherzer, E., Thurnher, M., Auer, B., and Schweiger,
M. (1988) EMBO J 7, 4151-4156
9. Schneider, R., and Schweiger, M. (1991) Oncogene 6, 1807-1811
10. Rothberg, J., Jacobs, J., Goodman, C., and Artavanis-Tsakonas, S. (1990)
Genes Dev 4, 2169-2187
11. Patthy, L. (2000) Trends Biochem Sci 25, 12-13
12. Katso, R. M., Manek, S., Ganjavi, H., Biddolph, S., Charnock, M. F., Bradburn, M.,
Wells, M., and Ganesan, T. S. (2000) Clin Cancer Res 6, 3271-3281
13. Halford, M. M., Armes, J., Buchert, M., Meskenaite, V., Grail, D., Hibbs, M. L.,
Wilks, A. F., Farlie, P. G., Newgreen, D. F., Hovens, C. M., and Stacker, S. A.
(2000) Nat Genet 25, 414-418
14. Orioli, D., Henkemeyer, M., Lemke, G., Klein, R., and Pawson, T. (1996) EMBO J
15, 6035-6049
15. Holder, N., and Klein, R. (1999) Development 126, 2033-2044
16. Feng, G. P., Laskowski, M. B., Feldheim, D. A., Wang, H. M., Lewis, R., Frisen,
J., Flanagan, J. G., and Sanes, J. R. (2000) Neuron 25, 295-306
17. Tessier-Lavigne, M. (1995) Cell 82, 345-348
18. Linnemann, T., Geyer, M., Jaitner, B. K., Block, C., Kalbitzer, H. R., Wittinghofer,
A., and Herrmann, C. (1999) J Biol Chem 274, 13556-13562
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 19: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/19.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
19
19. Kuriyama, M., Harada, N., Kuroda, S., Yamamoto, T., Nakafuku, M., Iwamatsu,
A., Yamamoto, D., Prasad, R., Croce, C., Canaani, E., and Kaibuchi, K. (1996) J
Biol Chem 271, 607-610
20. Hock, B., Bohme, B., Karn, T., Yamamoto, T., Kaibuchi, K., Holtrich, U., Holland,
S., Pawson, T., Rubsamen-Waigmann, H., and Strebhardt, K. (1998) Proc Natl
Acad Sci U S A 95, 9779-9784
21. Buchert, M., Schneider, S., Meskenaite, V., Adams, M. T., Canaani, E., Baechi,
T., Moelling, K., and Hovens, C. M. (1999) J Cell Biol 144, 361-371
22. Holland, S. J., Gale, N. W., Mbamalu, G., Yancopoulos, G. D., Henkemeyer, M.,
and Pawson, T. (1996) Nature 383, 722-725
23. Henkemeyer, M., Marengere, L. E., McGlade, J., Olivier, J. P., Conlon, R. A.,
Holmyard, D. P., Letwin, K., and Pawson, T. (1994) Oncogene 9, 1001-1014
24. Halford-M-M, O.-A.-C., Hibbs-M-L, Wilks-A-F, Stacker-S-A. (1999) J Biol Chem
274, 7379-7390
25. Katso, R. M., Manek, S., Biddolph, S., Whittaker, R., Charnock, M. F., Wells, M.,
and Ganesan, T. S. (1999) Cancer Res 59, 2265-2270
26. Songyang, Z., Fanning, A. S., Fu, C., Xu, J., Marfatia, S. M., Chishti, A. H.,
Crompton, A., Chan, A. C., Anderson, J. M., and Cantley, L. C. (1997) Science
275, 73-77
27. Kornau, H., Schenker, L., Kennedy, M., and Seeburg, P. (1995) Science 269,
1737-1740
28. Kim, E., Niethammer, M., Rothschild, A., Jan, Y. N., and Sheng, M. (1995)
Nature 378, 85-88
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 20: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/20.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
20
29. Kroiher, M., Miller, M. A., and Steele, R. E. (2001) Bioessays 23, 69-76
30. Alroy, I., and Yarden, Y. (1997) FEBS Lett 410, 83-86
31. Dierks, T., Lecca, M. R., Schmidt, B., and von_Figura, K. (1998) Febs Letters
423, 61-65
32. Morris, D. P., Stevens, R. D., Wright, D. J., and Stafford, D. W. (1995) J Biol
Chem 270, 30491-30498
33. Vecchi, M., Rudolph_Owen, L. A., Brown, C. L., Dempsey, P. J., and Carpenter,
G. (1998) J Biol Chem 273, 20589-20595
34. Downing, J. R., Roussel, M. F., and Sherr, C. J. (1989) Mol Cell Biol 9, 2890-
2896
35. Yee, N. S., Langen, H., and Besmer, P. (1993) J Biol Chem 268, 14189-14201
36. Yee, N. S., Hsiau, C. W., Serve, H., Vosseller, K., and Besmer, P. (1994) J Biol
Chem 269, 31991-31998
37. Jeffers, M., Taylor, G. A., Weidner, K. M., Omura, S., and Vande_Woude, G. F.
(1997) Mol Cell Biol 17, 799-808
38. Cabrera, N., Diaz_Rodriguez, E., Becker, E., Martin_Zanca, D., and Pandiella, A.
(1996) J Cell Biol 132, 427-436
39. McCarthy, M. J., Burrows, R., Bell, S. C., Christie, G., Bell, P. R., and Brindle, N.
P. (1999) Lab Invest 79, 889-895
40. O_Bryan, J. P., Fridell, Y. W., Koski, R., Varnum, B., and Liu, E. T. (1995) J Biol
Chem 270, 551-557
41. Saito, Y., Haendeler, J., Hojo, Y., Yamamoto, K., and Berk, B. (2001) Mol Cell
Biol 21, 6387-6394
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 21: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/21.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
21
42. Callahan, C. A., Bonkovsky, J. L., Scully, A. L., and Thomas, J. B. (1996)
Development 122, 2761-2767
43. Callahan, C. A., Muralidhar, M. G., Lundgren, S. E., Scully, A. L., and Thomas, J.
B. (1995) Nature 376, 171-174
44. Bonkowsky, J. L., and Thomas, J. B. (1999) Mech Dev 82, 181-184
45. Bonkowsky, J. L., Yoshikawa, S., O_Keefe, D. D., Scully, A. L., and Thomas, J. B.
(1999) Nature 402, 540-544
46. Pinkas_Kramarski, R., Shelly, M., Guarino, B. C., Wang, L. M., Lyass, L., Alroy, I.,
Alimandi, M., Kuo, A., Moyer, J. D., Lavi, S., Eisenstein, M., Ratzkin, B. J., Seger,
R., Bacus, S. S., Pierce, J. H., Andrews, G. C., Yarden, Y., and Alamandi, M.
(1998) Mol Cell Biol 18, 6090-6101
47. Pinkas_Kramarski, R., Soussan, L., Waterman, H., Levkowitz, G., Alroy, I.,
Klapper, L., Lavi, S., Seger, R., Ratzkin, B. J., Sela, M., and Yarden, Y. (1996)
EMBO J 15, 2452-2467
48. Ferguson, K. M., Darling, P. J., Mohan, M. J., Macatee, T. L., and Lemmon, M. A.
(2000) EMBO J 19, 4632-4643
49. Jardine, L. J., Milne, D. M., Dumaz, N., and Meek, D. W. (1999) Oncogene 18,
7602-7607
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 22: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/22.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
22
Figure legends
Fig. 1. Transient expression of RYK. HEK 293T cells were transfected with a C-
terminal V5-tagged RYK (RYK.V5), and the receptor was immunoprecipitated with an
anti-V5 antibody. (A) immunoblotting with the anti-V5 antibody. (B) immunoblotting with
the RYK3 antibody, raised against the extracellular domain of RYK. (C)
immunoblotting with the 15.2 antibody, raised against a C-terminal peptide from RYK.
The arrows indicate the different sizes of RYK protein.
Fig. 2. In vitro kinase assay. EphB3 was immunoprecipitated from transfected HEK
293T cells using an anti-HA-tag antibody. The purified, N-terminally His-tagged
catalytic domain of RYK (RYK.cat) was bound to protein G coated agarose beads
using an anti-His antibody. An in vitro kinase assay was performed, as described in
experimental procedures. (A) immunoblotting with an anti-phosphotyrosine antibody
shows that RYK.cat is not phosphorylated, whereas EphB3 is detected. (B) the anti-
His antibody detects RYK.cat. (C) the anti-HA antibody detects EphB3.
Fig. 3. Association and phosphorylation of EphB3 and RYK. HEK 293T cells were
transfected with the indicated constructs, and RYK was immunoprecipitated using an
anti-V5 antibody. (A) the anti-HA antibody detects both the wild type and kinase dead
mutant forms of EphB3 (EphB3 and EphB3 K665R respectively) when they are co-
transfected with RYK. (B) the anti-V5 antibody detects RYK. (C) the anti-HA antibody
detects both EphB3 constructs in the cell lysate. (D) the anti-phosphotyrosine antibody
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 23: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/23.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
23
detects phosphorylation of EphB3WT only when it is co-expressed with RYK, whereas
phosphorylation of RYK is not detected.
Fig. 4. In vitro kinase assay using full length RYK as a substrate. EphB3, RYK.V5
and AF-6 were immunoprecipitated from transfected HEK 293T cells using an anti-
HA, an anti-V5 and an anti AF-6 antibody respectively. An in vitro kinase assay was
performed using immunoprecipitated EphB3 as a kinase and RYK.V5 or AF-6 as
substrates, as described in experimental procedures. (A) the anti-phosphotyrosine
antibody blot shows phosphorylation of EphB3 and AF-6 when they are present in the
kinase assay. (B) presence of RYK detected by the anti-V5 antibody. (C) presence of
AF-6 detected by the anti-AF-6 antibody. (D) presence of EphB3 detected by the anti-
HA antibody.
Fig. 5. Association between EphB3 and RYK. HEK 293T cells were transfected with
the indicated constructs, and EphB3 was immunoprecipitated using an anti-HA
antibody. (A) the anti-V5 antibody detects RYK (shown by arrows) in the cell lysate of
transfected cells, but only detects it in the immunoprecipitates when RYK is
expressed with EphB3. (B) the anti-HA antibody shows EphB3 was expressed and
immunoprecipitated.
Fig. 6. Association and phosphorylation of EphB2 and RYK. HEK 293T cells were
transfected with the indicated constructs, and EphB2 was immunoprecipitated, using
an anti-EphB2 antibody. (A) the anti-V5 antibody detects RYK in the
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 24: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/24.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
24
immunoprecipitates only when it is co-expressed with EphB2. (B) immunoblotting
with the anti EphB2 antibody shows that EphB2 was immunoprecipitated. (C) the cell
lysate was immunoblotted with the anti-V5 antibody to show that RYK is expressed.
(D) the anti-phosphotyrosine antibody reveals phosphorylation of EphB2 but does not
detect any phosphorylation of RYK.
Fig. 7. Absence of interaction between EphB3 and TrkA:RYK. HEK 293T cells were
transfected with the indicated constructs, and EphB3 was immunoprecipitated using
an anti-HA antibody. TrkA was used as a negative control (A) the anti-Trk antibody
detects TrkA and TrkA:RYK in the cell lysate 9shown by arrows) but not in the
immunoprecipitates. (B) the anti-HA antibody shows that EphB3 is expressed and
immunoprecipitated.
Fig. 8. Absence of interaction between EphB3 and RYKEC. HEK 293T cells were
transfected with the indicated constructs, and EphB3 was immunoprecipitated using
an anti-HA antibody. (A) the anti-GFP antibody does not detect RYKEC in the
immunoprecipitates. (B) the anti-GFP antibody shows that RYKEC was expressed.
(C) the anti-HA antibody shows that EphB3 was expressed and immunoprecipitated.
Fig. 9. Comparison of the C-terminal end of RYK across species.10 The C-terminal
residues of Drosophila, Human and Mouse RYK (Acc.nº NP_477341, S58885,
P34925, Q01887 respectively) were aligned using Clustal-X and displayed with
10 DNT, Doughnut
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 25: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/25.jpg)
RYK’s interaction with EphB2, EphB3 and AF-6
25
MacBoxShade.
Fig. 10. Absence of interaction between AF-6 and TrkA:RYK. HEK 293T cells were
transfected with the indicated constructs; EphB3 was used as a positive control. (A)
and (B) AF-6 was immunoprecipitated with an anti-AF-6 antibody but TrkA:RYK is not
detected in the immunoprecipitates, although it is present in the cell lysate. In the
untransfected lane, the anti-AF-6 antibody detects endogenous AF-6. (C) and (D)
TrkA:RYK was immunoprecipitated but AF-6 is not detected in the
immunoprecipitates, although it is present in the cell lysate. (E) and (F) AF-6 was
immunoprecipitated using an anti-myc antibody, and EphB3 is detected in the
immunoprecipitate and the cell lysate.
Fig. 11. Absence of interaction between AF-6 and the catalytic domain of RYK. A
binding assay was carried out between AF-6 and the purified catalytic domain of RYK
(RYK.cat) as described in “experimental procedures”. In the presence of
immunoprecipitated AF-6 (myc-AF-6) from transfected HEK 293T cells and purified
RYK catalytic domain (RYK.cat) in PBSA, no binding was detected after blotting with
the anti-His antibody (A). (B) and (C) show that AF-6 and RYK.cat, respectively, were
present in the reaction.
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 26: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/26.jpg)
123
71
48
123
71
48
123
71
48
- + - + - + RYK.V5
IP V5IB V5
IP V5IB RYK3
IP V5IB 15.2
A B C
26
Fig.1 by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 27: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/27.jpg)
173
111
80
61
49
36
36
173
111
His
.RY
K.c
at
HA
.Ep
hB
3
IB PTyr
IB His
IB HA
A
B
C
27
Fig. 2
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 28: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/28.jpg)
111
80
61
49
111
173
111
80
61
49
- + - + - + RYK.V5- - + + - - HA.EphB3- - - - + + HA.EphB3K665R
IP V5IB HA
IP V5IB V5
Cell LysateIB HA
IP V5IB PTyr
D
B
A
C
28
Fig.3
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 29: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/29.jpg)
184
121
8669
52
40
8669
52
40
184
184
121
+ - myc.AF-6 protein
- + RYK.V5 protein
+ + HA.EphB3 protein
IB PTyr
IB V5
IB AF-6
IB HA
A
B
C
D
29
Fig. 4
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 30: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/30.jpg)
80
61
49
36
121
- + + - + +- - + - - + HA.EphB3
CellLysate IP HA
IB V5
IB HA
RYK.V5
A
B
Fig. 5
30
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 31: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/31.jpg)
86
69
52
40
184
121
8669
52
40
184
121
8669
52
40
- + - + RYK.V5
- - + + EphB2
IP EphB2IB V5
IP EphB2IB EphB2
Cell LysateIB V5
IP EphB2IB PTyr
A
B
C
D
Fig. 6
31
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 32: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/32.jpg)
204
122
102
122
- + + - + + HA.EphB3
- - + - - + TrkA:RYK
- + - - + - TrkA
CellLysate IP HA
IB Trk
IB HA
A
B
Fig.7
32
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 33: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/33.jpg)
86
69
86
69
184
121
- + - + HA.EphB3
- - + + RYKEC.GFP
IP HAIB GFP
Cell LysateIB GFP
IP HAIB HA
A
B
C
Fig. 8
33
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 35: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/35.jpg)
204
122102
122102
204
- - + - - + - + + - + + - - + - - + myc.AF-6- + + - + + - - + - - + - - - - - - TrkA:RYK - - - - - - - - - - - - - + + - + + HA.EphB3
CellLysate IP AF-6
CellLysate IP 5C3
IB AF-6IB Trk
IB AF-6IB Trk
A
B
C
D
CellLysate IP myc
122102
204
IB HA
IB AF-6
E
F
Fig. 10
35
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 36: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/36.jpg)
36
217
123
36
- + myc.AF-6
+ + His.RYK.cat
IP mycIB His
IP mycIB myc
reaction mixIB His
A
B
C
Fig.11
36
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 37: 1 RYK, a catalytically inactive receptor tyrosine kinase, associates](https://reader031.vdocuments.us/reader031/viewer/2022020301/58a19e511a28ab1f238b8ef9/html5/thumbnails/37.jpg)
Elisabeth Trivier and Trivadi S. GanesanEphB3, but does not interact with AF-6
RYK, a catalytically inactive receptor tyrosine kinase, associates with EphB2 and
published online April 15, 2002J. Biol. Chem.
10.1074/jbc.M202486200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 12, 2018
http://ww
w.jbc.org/
Dow
nloaded from