1 research article - plantphysiol.org · 116 cultivar scarlett (ssp. vulgare). here, we report the...

1

Research article 1

Short title: Drought-inducible proline accumulation in barley 2

3

An ancestral allele of Pyrroline-5-carboxylate synthase1 promotes proline 4

accumulation and drought adaptation in cultivated barley 5

6

One-sentence summary: Allelic variation of Pyrroline-5-carboxylate synthase1 7

underlies sequence divergence across the promoter in the cultivated and wild barley 8

which modulates its drought-inducible transcriptional activity. 9

10

Shumaila Muzammil$1: [email protected] 11

Asis Shrestha$1: [email protected] 12

Said Dadshani1: [email protected] 13

Klaus Pillen2: [email protected] 14

Shahid Siddique3: [email protected] 15

Jens Léon1: [email protected] 16

Ali Ahmad Naz1*: [email protected] 17

1University of Bonn, Institute of Crop Science and Resource Conservation, 18

Department of Plant Breeding, Katzenburgweg 5, 53115 Bonn, Germany. 19

2Martin-Luther University Halle-Wittenberg, Halle (Saale), Institute of Agricultural and 20

Nutritional Sciences, Department of Plant Breeding, Betty-Heimann-Str. 3, 06120 21

Halle (Saale), Germany. 22

3University of Bonn, Institute of Crop Science and Resource Conservation, Molecular 23

Phytomedicine, Karlrobert-Kreiten-Straße 13, 53115 Bonn, Germany. 24

25

$Authors with equal contribution 26

*Corresponding author 27

PD Dr. Ali Ahmad Naz 28

Email: [email protected] 29

Phone: +49 228 732752, Fax: +49 228 732045 30

Plant Physiology Preview. Published on August 21, 2018, as DOI:10.1104/pp.18.00169

Copyright 2018 by the American Society of Plant Biologists

www.plantphysiol.orgon September 17, 2018 - Published by Downloaded from Copyright © 2018 American Society of Plant Biologists. All rights reserved.

mailto:[email protected]






http://www.plantphysiol.org

2

31

Author contributions 32

A.A.N. and J.L. conceived the research idea and plans; S.M., A.S., S.D. and A.A.N. 33

carried out the phenotypic experiment and data analysis; K.P. established the S42IL 34

population and the high-resolution population S42IL-143HR for mapping and QTL 35

cloning; A.A.N., S.M., A.S. and J.L. performed QTL mapping and positional cloning; 36

S.S., A.S. performed the transient expression assays; A.A.N., A.S., S.D., S.M. and 37

S.S. wrote the manuscript. 38

39

Abstract 40

Water scarcity is a critical threat to global crop production. Here, we used the natural 41

diversity of barley (Hordeum vulgare) to dissect the genetic control of proline-42

mediated drought stress adaptation. Genetic mapping and positional cloning of a 43

major drought-inducible quantitative trait locus (QTL; QPro.S42-1H) revealed unique 44

allelic variation in pyrroline-5-carboxylate synthase (P5cs1) between the cultivated 45

cultivar Scarlett (ssp. vulgare) and the wild barley accession ISR42-8 (ssp. 46

spontaneum). The putative causative mutations were located in the promoter of 47

P5cs1 across the DNA binding motifs for abscisic acid-responsive element binding 48

transcription factors (ABFs). Introgression line (IL) S42IL-143 carrying the wild allele 49

of P5cs1 showed significant up-regulation of P5cs1 expression compared to Scarlett, 50

which was consistent with variation in proline accumulation under drought. Next, we 51

transiently expressed promoter::reporter constructs of ISR42-8 and Scarlett alleles in 52

Arabidopsis (Arabidopsis thaliana) mesophyll protoplasts. β-glucuronidase (GUS) 53

expression analysis showed a significantly higher activation of the ISR42-8 promoter 54

compared to Scarlett upon abscisic acid treatment. Notably, the ISR42-8 promoter 55

activity was impaired in protoplasts isolated from the loss-of-function 56

abf1abf2abf3abf4 quadruple mutant. A series of phenotypic evaluations 57

demonstrated that S42IL-143 maintained leaf water content and photosynthetic 58

activity longer than Scarlett under drought. These findings suggest that the ancestral 59

variant of P5cs1 has the potential for drought tolerance and understanding drought 60

physiology of barley and related crops. 61



3

Introduction 62

Land plants evolved from algae approximately 500 million years ago and established 63

themselves in a terrestrial habitat (Graham, 1993). This evolution was possible as 64

plants developed multiple physiological and biochemical strategies to accomplish life 65

under water-limiting conditions. The biosynthesis of osmotic compounds of low 66

molecular weight, such as proline, glycine betaine, mannitol and organic acids, 67

seems to be an essential evolutionary event to conserve water in the terrestrial 68

habitat (Blum, 2017). The effect of these evolutionary changes can be seen as 69

unique adaptive strategies among the natural population (wild progenitors) of crop 70

plants. Therefore, the genetic dissection of diverse genetic resources is essential to 71

understand the drought physiology of crop plants as well as to develop drought-72

resilient cultivars. 73

Proline is a compatible solute and a highly soluble organic compound. It is located 74

mainly in the cytosol, chloroplasts and cytoplasmic compartments to protect cellular 75

components from dehydration injury during osmotic stress (Szabados and Savoure, 76

2010). In addition, it contributes to stabilizing sub-cellular structures (e.g. membranes 77

and proteins), scavenging free radicals and buffering cellular redox potential under 78

stress conditions (Ashraf and Foolad, 2007). Thus, proline is commonly referred to as 79

an osmolyte or osmoprotectant. As an osmolyte, it has a role in plant responses to 80

drought stress and climatic adaptation, including signal transduction, osmoregulation 81

and antioxidant systems (Kishor et al., 2005; Kesari et al., 2012). 82

Proline is synthesized primarily from glutamate by the action of the pyrroline-5-83

carboxylate synthase (P5CS) and pyrroline-5-carboxylate reductase (P5CR) 84

enzymes. In the first step, P5CS converts glutamate to glutamate-semialdehyde (Hu 85

et al., 1992), which is subsequently reduced by P5CR to proline (Szoke et al., 1992; 86

Verbruggen et al., 1993). In many plant species, there exist two conserved P5CS 87

genes, P5CS1 and P5CS2, which share approximately 82% nucleotide and 94% 88

amino acid sequence identity. However, these genes are differentially regulated at 89

the transcriptional level (Strizhov et al., 1997; Székely et al., 2008). In Arabidopsis 90

(Arabidopsis thaliana), P5CS2 modulates housekeeping proline biosynthesis in the 91

cytosol, whereas up-regulation of P5CS1 in the chloroplast results in drought-92

inducible proline accumulation. Arabidopsis P5CS1 is induced by osmotic and salt 93

stresses and activated by the abscisic acid (ABA)-dependent regulatory pathway as 94

well as H2O2-derived signals (Szabados and Savoure, 2010). Under ABA signals, 95



4

ABA-responsive element (ABRE) binding proteins (AREB) or transcription factors 96

(ABFs) like ABF1, ABF2/AREB1, ABF3 and ABF4/AREB2 regulate the expression of 97

drought-inducible genes (Yoshida et al., 2015). ABFs are a group of basic leucine 98

zipper (bZIP) domain transcription factors, which were discovered using ABREs as 99

bait in yeast one-hybrid screens (Choi et al., 2000; Uno et al., 2000). It has been 100

reported that ABREs require other copies of ABREs or the combination of an ABRE 101

with one of several coupling elements (CE) across the promoter region to form the 102

ABA response complex (Shen et al., 1996). Hobo et al. (1999) showed that ABRE 103

with ACGT core and CE3 are functionally equivalent and can be considered as a 104

single class of cis-acting elements. 105

Although much is known about proline metabolism in model plants, the genetics and 106

utility are poorly understood as a trait in crops because of quantitative inheritance of 107

proline accumulation, especially under drought conditions (Kishor et al., 2005; 108

Szabados and Savoure, 2010). This scenario demands quantitative analysis of 109

drought-inducible proline accumulation among the natural population of crop plants. 110

In the present study, we employed a quantitative approach to dissect the genetic and 111

molecular regulation of proline accumulation under drought conditions in barley 112

(Hordeum vulgare). For this, we employed a set of introgression lines (ILs) 113

harbouring genome-wide marker-defined chromosomal segments of an ancestral wild 114

barley accession, ISR42-8 (ssp. spontaneum), in the background of spring barley 115

cultivar Scarlett (ssp. vulgare). Here, we report the positional isolation and molecular 116

analysis of a novel drought-inducible P5cs1 allele originated from wild barley 117

accession ISR42-8. 118

Results 119

P5cs1 allelic variation is associated with the major quantitative trait locus 120

(QTL) effect for drought-inducible proline accumulation in barley 121

Initial screening of drought-inducible proline accumulation was performed in IL 122

population designated as S42IL, which contains genome-wide wild barley ISR42-8 123

introgressions in the Scarlett background. This population exhibited a wide range of 124

variation in proline accumulation, especially under drought stress conditions 125

(Supplemental Fig. S1). For mapping, we compared individual ILs with the recurrent 126

parent Scarlett using the Dunnett-test. This analysis identified a major drought-127

inducible QTL QPro.S42-1H on chromosome 1H, where two ILs, S42IL-143 and 128


http://www.plantphysiol.org/cgi/content/full/pp.112.208694/DC1

http://www.plantphysiol.org/cgi/content/full/pp.112.208694/DC1


5

S42IL-141, sharing a common wild barley introgression resulted in significantly higher 129

proline accumulation (Fig. 1A). In the next step, we confirmed this QTL effect by re-130

phenotyping the four selected ILs carrying wild and cultivated alleles at the target 131

QTL region. Quantification of these ILs along with parental genotypes showed a 132

significant increase in proline accumulation in S42IL-143 and S42IL-141 up to 2420 133

μg/g under drought stress (Fig. 1B). High concentrations of proline produce a red 134

colour after reaction with ninhydrin. Thus, a dark red colour indicated more proline in 135

the QTL allele harbouring IL, S42IL-143 and S42IL-141 (Fig. 1C). Using a diagnostic 136

marker (M-L), we confirmed that both ILs carried wild introgressions at the QPro.S42-137

1H region (Supplemental Fig. S2). Further, we validated this QTL effect and its 138

segregation using 237 BC4S2 plants derived from S42IL-143 (Supplemental Fig. S3). 139

Positional cloning of QPro.S42-1H was conducted using 3300 BC4S2 plants derived 140

from S42IL-143. Initial mapping helped us to refine the targeted interval to 1.6 cM 141

between left and right border KASP markers derived from SNP:TP59951 and 142

SNP:TP3687 (Fig. 2A, Supplemental Table S1). By KASP genotyping we identified 143

85 recombinants out of 3300 plants which segregated for the targeted QTL region. 144

Later, these recombinants were quantified for proline accumulation under drought 145

(Supplemental Fig. S4). Next, we incorporated two additional markers at the left (M-146

L) and right (M-R) border of the most promising candidate gene, P5cs1, which 147

encodes a P5CS enzyme protein. By incorporating M-L and M-R, we established an 148

interval that carried no additional high confidence genes except P5cs1 (Fig. 2B, 149

Supplemental Table S2). The genotyping of M-L and M-R markers in 12 segregants 150

and their comparison with proline accumulation data revealed six recombinants at 151

each left and right border indicating that the causal mutation influencing QPro.S42-152

1H lies within P5cs1. P5cs1 was oriented in the reverse strand and comprised of 20 153

exons encoding 716 amino acids. Notably, we found two high-proline recombinants 154

(R1, R3), which were heterozygous at the 3´ UTR of P5cs1 but carried ISR42-8 155

homozygous alleles at the 5´ promoter of P5cs1. Next, we developed an additional 156

marker, M-P5cs1-Pro, at the P5cs1 promoter region (Supplemental Table S2). 157

Notably, at this marker, ISR42-8 and Scarlett alleles revealed 100% co-segregation 158

with high and low proline phenotypes, respectively. The heterozygous recombinants 159

exhibited a marginal increase in proline accumulation under drought stress conditions 160

(Fig. 2C). Sequencing of P5cs1 in ISR42-8 and Scarlett revealed a single nucleotide 161

polymorphism (SNP; A/G) in exon 15 that resulted in an amino acid substitution from 162



6

histidine (ISR42-8) to arginine (Scarlett), along with three additional silent SNPs in 163

exon 7 and 9 (Fig. 2D). To prove if the amino acid substitution was associated with 164

proline variation, we developed marker M-P5cs1-Cds at the substitution site via 165

recombinant sequencing. Similar to M-L, this marker indicated the causal mutation 166

upstream of the amino acid substitution towards the 5´ promoter region of P5cs1 (Fig. 167

2C). These results suggest that the allelic variation of P5cs1 controls the drought-168

inducible QTL (QPro.S42-1H) effect in ISR42-8 and Scarlett. 169

Drought-inducible proline accumulation in S42IL-143 involves P5cs1 induction 170

Proline accumulation upon water stress is preceded by increased expression of 171

P5cs1 (Hu et al., 1992). Therefore, we hypothesized that the differential accumulation 172

of proline between Scarlett and S42IL-143 during water stress might also involve 173

changes in the expression of P5cs1. To investigate this, we analysed the expression 174

of P5cs1 in Scarlett and S42IL-143 under varying water stress conditions. The leaf 175

samples were collected at three different time points after drought stress: 3 days after 176

stress (DAS), 6 DAS and 9 DAS. RNA was extracted and analysed for the expression 177

of P5cs1 via quantitative RT-PCR (qRT-PCR). There were no significant changes in 178

the expression of P5cs1 mRNA between Scarlett and S42IL-143 under control 179

conditions. However, a significant increase in P5cs1 expression was observed in 180

S42IL-143 at 6 days after stress (DAS) and 9 DAS, whereas a significant increase 181

was only observed 9 DAS in Scarlett (Fig. 3A). Next, we tested whether this 182

significant increase in P5cs1 expression was proportional to proline accumulation. 183

For this, we quantified the proline content in the same leaf samples used for 184

expression analysis. Intriguingly, we observed that the proline accumulation in S42IL-185

143 and Scarlett followed the same trend as P5cs1 mRNA expression in response to 186

water stress (Fig. 3B). These data suggested that the QTL bearing IL S42IL-143 187

showed a drought-inducible up-regulation of P5cs1, followed by a proportional 188

increase in proline content. 189

190

Promoter divergence at the ABF binding sites putatively determines P5cs1 191

allelic variation 192

Recombination and gene expression analyses suggested that the causal mutations 193

controlling drought-inducible proline accumulation may lie in the promoter of P5cs1. 194

Therefore, we sequenced an approximately 1.5 kb region upstream of ATG in ISR42-195

8 and Scarlett. The sequence comparison revealed mutations across putative ABREs 196



7

and related CE3 motifs between Scarlett and ISR42-8 (Fig. 4). Based on this, we 197

assumed that these mutations may influence the DNA binding of ABFs in the P5cs1 198

promoter. To investigate this, we established promoter::reporter constructs for ISR42-199

8 (pISR::eGFP-GUS) and Scarlett (pSCA::eGFP-GUS). Next, we transiently 200

expressed the pISR::eGFP-GUS or pSCA::eGFP-GUS constructs in protoplasts 201

isolated from Arabidopsis leaf mesophyll cells. Transfection efficiency was estimated 202

using the GFP reporter (Supplemental Fig. S5). We then incubated transfected 203

protoplasts of Col-0 ecotype in the presence of ABA (50 μM) for 4 hours and 204

analyzed the expression of GUS, ABF1, ABF2, ABF3 and ABF4 via reverse 205

transcription quantitative PCR (RT-qPCR). The expression of all four ABFs was 206

substantially induced upon ABA treatment in both pISR::eGFP-GUS- and 207

pSCA::eGFP-GUS-transfected protoplasts. Similarly, expression of the GUS gene 208

was strongly and significantly induced upon ABA treatment in pISR::eGFP-GUS 209

transfected protoplasts; however, only modest up-regulation in GUS expression was 210

observed in pSCA::eGFP-GUS-transfected protoplasts (Fig. 5A). To determine 211

whether up-regulation of GUS expression in pISR::eGFP-GUS-transfected 212

protoplasts was mediated by ABFs, we transfected this construct into mesophyll 213

protoplasts isolated from the wild-type Arabidopsis (Col-0) and loss of function 214

abf1abf2abf3abf4 quadruple mutant. Notably, we found that the up-regulation of GUS 215

activity upon ABA treatment was significantly impaired in abf1abf2abf3abf4 as 216

compared to the wild-type (Fig. 5B). Taken together, these data suggest significantly 217

different promoter activity of Scarlett and ISR42-8 alleles might be regulated in an 218

ABF-dependent manner. 219

S42IL-143 maintains higher leaf water status and photosynthetic activity under 220

drought stress compared to Scarlett 221

Plants affected by drought stress undergo changes in physiological processes 222

involved in photosynthesis, such as stomatal conductance (gs), transpiration rate (E) 223

and intercellular CO2 concentration (Ci). We investigated these parameters non-224

destructively using an infrared gas exchange analyser (LI-6400XT, LICOR Inc., 225

Lincoln, NE, USA). We found a significant reduction in gs in Scarlett under drought as 226

compared to control conditions (Supplemental Fig. S6A). S42IL-143 maintained 227

similar gs in both conditions at 3 DAS and 6 DAS, but drought reduced gs significantly 228

at 9 DAS (Supplementary Fig. S6B). The effects of drought on E were similar to 229

those of gs in both Scarlett and S42IL-143 (Supplementary Fig. S6C-D). The influx of 230



8

CO2, which is essential for carbon assimilation and photosynthetic activity, is directly 231

affected by gs. We found that the internal Ci remained constant for both genotypes 232

under control conditions until 6 DAS. However, the slope of Ci decline in Scarlett was 233

40% lower than that of S42IL-143 at 9 DAS (Supplementary Fig. S6E-F). 234

Consequently, we measured the photosynthetic rate (A), which was significantly 235

reduced by drought in Scarlett at 3, 6, and 9 DAS (Fig. 6A). No significant difference 236

in A was observed in S42IL-143 at 3 and 6 DAS, but a marginal reduction due to 237

drought was observed at 9 DAS. A in S42IL-143 was 3-fold higher than in Scarlett 238

under extreme drought conditions (Fig. 6B). In addition, we measured the effective 239

quantum yield of photosystem II (YII) at steady-state photosynthesis under light using 240

a MINI-PAM-II to confirm photosynthetic activity. YII in Scarlett was significantly 241

reduced by drought at 9 DAS, whereas no significant difference was observed in 242

S42IL-143 (Fig. 6 C-D). These data suggest an increased photosynthetic activity due 243

to the QTL allele bearing-IL S42IL-143 under drought stress conditions. In addition, 244

we assessed the dynamics of the water status of Scarlett and S42IL-143 leaves 245

under control and drought stress conditions using a microwave sensor. According to 246

Dadshani et al. (2015), the microwave parameter resonant frequency shift (FRS) 247

strongly correlates with the amount of water stored in leaf tissues. Under drought, 248

Scarlett showed a significant reduction in FRS value relative to control as compared 249

to S42IL-143 (Fig. 6E). To test if these differences influenced grain yield of Scarlett 250

and S42IL-143 under drought, we performed a pot experiment in the greenhouse 251

under control and drought stress conditions. Grain weight per plant was significantly 252

lower in Scarlett compared to S42IL-143 under drought stress conditions (Fig. 6F). 253

These data indicate that drought-inducible proline accumulation has a role in 254

modulating physiological tolerance in IL S42IL-143. 255

256

Discussion 257

In the present study, we focused on the major QTL QPro.S42-1H located on 258

chromosome 1H, as it yields the strongest drought-inducible effect on proline 259

accumulation in a library of wild barley ILs. Two independent IL, S42IL-143 and 260

S42IL-141, complemented this QTL effect due to the introgression of a wild P5cs1 261

allele in the Scarlett background. S42IL-143 and S42IL-141 carried wild 262

introgressions that shared a small common segment at the P5cs1 gene locus. This 263

arrangement of introgressions was advantageous to refine the target QTL interval 264



9

and to exclude the background effects of additional genes as the extent of QTL 265

QPro.S42-1H was almost similar in both ILs. Also, the near isogenic genetic 266

background of these ILs appeared more effective for the reproducibility of this 267

drought-inducible QTL during positional cloning. By this, we showed single gene 268

resolution of P5cs1 at the QTL region via high resolution recombination analysis 269

using six recombinants at each left and right borders of this gene. These findings are 270

also in line with the previous studies of proline metabolism in the model plant 271

Arabidopsis and related higher plants, which suggest a vital role of enzyme-encoding 272

gene P5CS1 for proline accumulation under drought stress conditions (Liang et al., 273

2013). 274

In the next step, we investigated sequence polymorphisms underlying genetic and 275

molecular regulation of the drought-inducible P5cs1 allele of ISR42-8. Intriguingly, we 276

found mutations in the promoters of Scarlett and ISR42-8 across the predicted 277

binding motifs of the ABF transcription factors. Previous reports have suggested that 278

ABFs are transcription factors that bind to ABREs and regulate ABA-responsive gene 279

expression (Choi et al., 2000; Uno et al., 2000). The ABF gene family is expressed in 280

vegetative tissues in response to ABA and osmotic stress in Arabidopsis, suggesting 281

a fundamental role in ABA-mediated drought stress tolerance (Fujita et al., 2011). All 282

ABF transcription factors carry four conserved domains in addition to the bZIP 283

domain (Fujita et al., 2011; Fujita et al., 2013). Transcription factors having a bZIP 284

domain target DNA duplex sites as homo- or heterodimers and bind to related but 285

distinct palindromic sequences (Ellenberger, 1994; Hurst, 1995). Shen et al. (1996) 286

shed interesting insight on the ABRE cis-elements; they found that these elements 287

require other copies of ABREs or the combination of an ABRE with one of several 288

CEs across the promoter region. These researchers also claimed that a single copy 289

of an ABRE was insufficient to activate ABA-responsive genes (Riley et al., 2008). 290

The role of multiple transcription factors binding sites (TFBS) is well documented in 291

other systems, e.g. G-box factor, in substantiating transcriptional up-regulation in 292

plants (Schulze-Lefert et al., 1989; Toniatti et al., 1990), which suggests that the 293

active role of multiple TFBS in gene up-regulation depends primarily on the targeting 294

transcription factor (TF) itself, the inter-TFB distance and the adjoining sequence of 295

the TFBS. In light of these reports, we proposed that the sequence polymorphisms in 296

ABREs and adjacent CEs across the promoter region of ISR42-8 and Scarlett may 297

influence the action of ABF transcription factors under ABA-modulated drought stress 298



10

cascades. In support of this hypothesis, we performed transient expression of 299

Scarlett and ISR42-8 promoter alleles in Arabidopsis (Col-0) protoplasts with or 300

without ABA treatment. We found significantly higher GUS expression in 301

pISR::eGFP-GUS upon ABA treatment. However, a significantly impaired GUS 302

expression was observed in the protoplasts transfected with pSCA::eGFP-GUS. To 303

test the putative role of ABFs, which bind on ABRE motifs, we expressed 304

pISR::eGFP-GUS in the protoplasts of Col-0 and the abf1abf2abf3abf4 quadruple 305

mutant. Notably, GUS activity was strongly impaired in abf1abf2abf3abf4 as 306

compared to Col-0. Altogether, these data suggest that P5cs1 allelic polymorphism 307

of ABRE motifs putatively regulate differential proline accumulation in ISR42-8 and 308

Scarlett under drought stress conditions. 309

Finally, we tested whether drought-inducible proline accumulation has a role in 310

mediating drought stress tolerance in S42IL-143. Several physiological 311

measurements, such as leaf water status, -, photosynthetic parameters and 312

efficiency of photochemistry, have been widely used as markers for evaluating 313

drought stress tolerance in various plant species (Souza et al., 2004; Chaves et al., 314

2009; Liu et al., 2015). Hence, we measured these parameters in S42IL-143 and 315

Scarlett under control conditions and drought stress. Water status, measured through 316

the microwave parameter FRS, demonstrated that S42IL-143 was able to maintain 317

higher tissue water status compared to Scarlett under drought conditions. Dadshani 318

et al. (2015) also found that FRS correlates positively with water status in barley 319

leaves. Gas exchange and photosynthetic rates are considered important 320

parameters in the determination of drought stress tolerance for rain-fed agriculture. It 321

is logical that reduced gs may result in the reduction of A in plants (Lawlor and 322

Tezara, 2009; Brestic and Zivcak, 2013; Hossain et al., 2015). However, several 323

reports confirm that drought-tolerant genotypes maintain open stomata and active 324

photosynthesis, even under dehydration conditions as compared to drought-sensitive 325

genotypes (Benešová et al., 2012; Hossain et al., 2015). Our data showed significant 326

reductions in gs and A occurring early under drought stress as compared to control 327

conditions in Scarlett, whereas significant reductions under drought in S42IL-143 328

occurred only in more severe instances of drought. These parameters are direct 329

indicators to characterize the efficiency of photochemistry under varying 330

environmental conditions (Rascher et al., 2000). According to Yuan et al. (2016), 331

plants that maintain YII under drought are recognized as stress-tolerant. Our results 332



11

also showed that the S42IL-143 maintained YII similar to control under drought, 333

unlike Scarlett. These data suggest that increased proline accumulation modulates 334

physiological parameters and drought tolerance in S42IL-143 due to the 335

introgression of a novel P5cs1 allele from wild barley. 336

In conclusion, the present study successfully demonstrated the isolation of a new 337

P5cs1 allele of wild origin. This QTL allele reveals promoter variation associated to 338

transcriptional induction of P5cs1, which was associated with subsequent proline 339

accumulation, thus improving drought tolerance. Future research will be focused to 340

prove a direct interaction between the causative DNA and regulatory proteins, which 341

will help to understand the molecular regulation of the ABA-driven proline cascade in 342

mediating drought tolerance. Further, we are refining the QTL allele bearing IL 343

S42IL-143 to fix the P5cs1 allele in the isogenic background of cultivated barley to 344

test the broader significance of proline accumulation for yield and yield sustainability 345

traits in barley under field conditions. 346

Materials and Methods 347

Initial screening and mapping of drought-inducible proline accumulation. 348

Initial genetic screening of proline accumulation was carried out in a population 349

(S42IL) of 72 wild barley introgression lines (IL). The S42IL lines (BC3S4:10) were 350

developed from an initial cross between the German spring cultivar Scarlett 351

(Hordeum vulgare ssp. vulgare) and the Israeli wild barley accession ISR42-8 (H. 352

vulgare ssp. spontaneum), followed by three rounds of backcrossing. The cultivar 353

Scarlett was used as the recurrent parent for subsequent backcrossing whereas 354

ISR42-8 was utilized as the donor of the drought-related traits. The development of 355

the S42IL population was described previously by Schmalenbach et al. (2008). 356

Phenotypic evaluation of the S42IL population for proline accumulation was made in 357

a split-plot design in two biological replicates of individual ILs under control and 358

drought conditions in a plastic tunnel. The treatments (control and drought) were 359

assigned to the sub-plots, within which the lines were assigned randomly. Seeds of 360

individual S42IL genotypes were sown in a plastic pot (22 × 22 × 26 cm) containing a 361

mixture of topsoil (40%) and natural sand (60%) (Terrasoil®, Cordel & Sohn, Salm, 362

Germany). Plants were watered three times a day using a drip irrigation system 363

(Netafilm, Adelaide, Australia). Echo2 sensors (Decagon Dev., Pullman WA, USA) 364

were used to determine the volumetric moisture content (VMC) digitally with the 365

frequency domain technique. The drought stress treatment was performed 30 days 366



12

after sowing (DAS) by eliminating the water supply completely at plant development 367

stage BBCH 29-31 (Lancashire et al., 1991). The plants were exposed to stress for 368

26 days until the VMC reached the maximum drought stress threshold that is close to 369

the wilting point (VMC near 0%). The control block was kept under a continuous 370

supply of irrigation. The first fully developed leaf of individual genotypes in each block 371

was harvested and flash frozen in liquid nitrogen for drought and control conditions 372

and stored at -80°C until proline determination. Colorimetric method of proline 373

determination described by Bates et al., 1973 was adopted for proline content 374

measurement. Proline accumulation was quantified in µg/g of the harvested fresh 375

leaf material. 376

The S42IL population was genotyped using an Illumina 1,536 SNP-array and 377

genotyping by sequencing approaches which have been already described 378

(Schmalenbach et al., 2011; Honsdorf et al., 2014). This SNP map was compared 379

among the individual introgression lines to map the QTL region associated with 380

drought-inducible proline accumulation. ILs showing significant drought-inducible 381

proline accumulation were identified by comparing the S42IL population with the 382

recurrent parent Scarlett under control and drought stress conditions using Dunnett-383

test (Dunnett, 1955; Naz et al., 2014). 384

385

QTL validation 386

The major QTL effect QPro.S42-1H was validated by quantifying two wild allele-387

bearing ILs, S42IL-143 and S42IL-141, in comparison to two cultivated allele-bearing 388

ILs, S42IL-130 and S42IL-133, for proline accumulation under control and drought 389

stress conditions inside the growth chamber. For this, each IL was evaluated in five 390

biological replicates along with the parental genotypes. The growth chamber was 391

supplied with 12 hours of artificial light at 22±2 °C with 50-60% relative humidity. For 392

proline content measurement, two week-old seedlings were exposed to drought 393

stress by eliminating water supply completely. 394

To test the segregation of QTL alleles, the experiment was performed in the S42IL-395

143HR population derived from S42IL-143. This population was developed via 396

backcrossing of QTL bearing S42IL-143 with Scarlett and two further rounds of 397

selfing (i.e. BC4S2) as described previously (Schmalenbach et al., 2008). Seeds of 398

the S42IL-143HR population and parents were sown in climate chambers under 399

control conditions. The pots were randomized after sowing a single seed per pot (10 400



13

× 10 × 12 cm). The growth chamber was supplied with 12 hours of artificial light at 401

22±2 °C with 50-60% relative humidity. Drought stress treatment was carried out 10 402

days after germination by eliminating the water supply completely. The treatment 403

pots were kept under stress, and the first fully expanded leaf was harvested from 404

drought and control conditions for proline measurement. Proline content was 405

measured nine days after drought treatment by the colorimetric procedure as 406

described previously (Bates et al., 1973). At least five independent biological 407

replicates of parents were used for proline content measurement. Higher proline 408

concentration was visualized by its reaction with ninhydrin. 409

For genotyping, a simple sequence length polymorphic (SSLP) marker M-L was 410

developed from a 3`UTR of the putative candidate gene P5cs1. This marker revealed 411

44 bp deletions in the ISR42-8 allele compared to the Scarlett allele. A total of 237 412

BC4S2 segregating progenies were genotyped using this diagnostic SSLP-marker 413

and phenotyped for proline variation under drought stress conditions. The allelic 414

polymorphism of Scarlett and ISR42-8 alleles was visualized on 2.5% standard 415

agarose gel. 416

417

Positional cloning of QTL QPro.S42-1H 418

For positional cloning, 3300 BC4S2 seeds of S42IL-143HR were sown along with 419

parental genotypes Scarlett and ISR42-8. In the next step, DNA was extracted from 420

fully expanded leaves of one-week old seedlings using the CTAB extraction method 421

according to a protocol devised by Virginia Tech Small Grains Breeding (Blacksburg, 422

Virginia, USA). For genotyping, two SNP derived KASP markers at the left (KASP-L) 423

and right (KASP-R) border of the QTL region were established. The KASP 424

genotyping was outsourced at TraitGenetics®, Gatersleben, Germany. All the 425

markers used for KASP genotyping used in this study are listed in Supplemental 426

Table S1. After KASP genotyping, recombinants were selected among the 3300 427

BC4S2 progenies that showed recombination between KASP-L and KASP-R 428

markers. These recombinants were then subjected to drought stress for 9 days, and 429

proline accumulation was measured as described previously (Bates et al., 1973). 430

Later, two additional SSLP markers, M-L and M-R, were incorporated to refine the 431

QTL region. These markers enabled refining the QTL region to a single candidate 432

gene. Later, a gene-specific marker (M-P5cs1-Pro) was established to compare the 433

co-segregation of Scarlett and ISR42-8 alleles with low and high proline phenotypes 434



14

under drought stress conditions, respectively. A list of markers and corresponding 435

primers sequence information is given in Supplemental Table S2. 436

437

Expression analysis of P5cs1 mRNA 438

Expression analysis of P5cs1 mRNA was performed in Scarlett and S42IL-143 under 439

varying drought stress conditions inside the growth chamber. The experiment was 440

designed in three biological replicates for each genotype in drought stress and 441

control treatments. Drought stress treatment was introduced to 10 day-old seedlings. 442

Later, leaf samples were harvested from each plant and flash frozen in liquid nitrogen 443

and stored at -80°C until further processing. Samples were collected 3 days after 444

stress (DAS), 6 DAS and 9 DAS from both control and stress treatments. RNA 445

extraction, purification, and quantification were performed using the TRIZOL RNA 446

Isolation Protocol. The Thermo Fisher RT-qPCR kit (Thermo Fisher, Rochester, 447

USA) was used for cDNA synthesis following the manufacturer’s instructions. RT-448

qPCR was performed in 96-well plates using a 7500 fast Real-time PCR System and 449

an SYBR Green-based PCR assay using three technical replicates of each cDNA 450

sample. Each reaction contained 3 μl cDNA, 10 μl Maxima® SYBR Green/ROX 451

qPCR Master Mix, and each primer at 0.4 μM to a final volume of 20 μl. The reaction 452

mix was subjected to the following conditions: 95°C for 10 min, followed by 45 cycles 453

of 95°C for 15 s and 60°C for 30 s. Melting curves were then analysed at 95°C for 15 454

s, 60°C for 15 s, and 95°C for 15 s. In addition, a reverse transcription negative 455

control was included to assess potential genomic DNA contamination. For each 456

cDNA sample, three technical replicates were used. Elongation factor (Ef1-a) was 457

used as an internal control gene. Relative expression of P5cs1 was calculated 458

according to the 2-ΔΔCt method (Livak and Schmittgen, 2001). A list of primer 459

sequences used for expression analysis is shown in Supplemental Table S3. 460

461

Promoter analysis 462

An approximately 1.5-kb region upstream from ATG of P5cs1 was sequenced for 463

ISR42-8 and Scarlett. The promoter sequence was aligned using MAFFT alignment 464

tools (Katoh et al., 2002). DNA binding motifs across the promoter were identified 465

using MULAN analysis (Ovcharenko et al., 2005) and the plant cis-acting regulatory 466

DNA elements (PLACE) database (Higo et al., 1999) 467

468



15

Transient expression of ISR42-8 and Scarlett promoter 469

Promoter regions upstream of the start codon of ISR42-8 (1534 bp) and Scarlett 470

(1537 bp) were synthesized commercially (Invitrogen, USA) and cloned in a Gateway 471

cloning vector pDONR221 (Invitrogen) according to the manufacturer’s instructions. 472

The verified promoters were fused with the eGFP-GUS tag in the expression vector 473

pBGWFS7 (Yoo et al., 2007). Transient expression analysis using Arabidopsis 474

(Arabidopsis thaliana) leaf mesophyll cells (treated with or without ABA) was 475

performed as described previously (Yoshida et al., 2002; Yoo et al., 2007; Yoshida et 476

al., 2015). A luciferase gene under the control of the 35S promoter (Karimi et al., 477

2005) was used as an internal control for GUS activity analysis between Col-0 and 478

the abf1abf2abf3abf4 quadruple mutant. The luciferase activity was performed using 479

the Luciferase Assay System (Promega, Cat. Mo. E1500) following the 480

manufacturer’s instructions. The abf1abf2abf3abf4 quadruple mutant was derived 481

from abf1 (SALK_132819), areb1/abf2 (SALK_002984), abf3 (SALK_096965) and 482

areb2/abf4 (SALK_069523) in Col-0 background (Yoshida et al., 2015). The seeds of 483

the quadruple mutant were kindly provided by Prof. Dr. Yamaguchi-Shinozaki’s lab. 484

Total RNA was extracted using an RNeasy plant mini kit (Qiagen) following the 485

manufacturer’s instructions. Contaminating DNA was digested with DNase1 using a 486

DNA-free™ DNA removal kit (Ambion), and the RNA was used to synthesize cDNA 487

using a high-capacity cDNA reverse transcription kit (Applied Biosynthesis, 488

Darmstadt, Germany) following the manufacturer’s instructions. RT-qPCR) was 489

performed with the StepOne plus real-time PCR system (Applied Biosystems) as 490

described recently (Mendy et al., 2017; Shah et al., 2017). The 18S ribosomal gene 491

was used as an endogenous control. For this, cDNA was diluted 1:100 for 18S 492

analysis. Data were analyzed using Pfaffl’s method (Pfaffl, 2001). A list of primer 493

sequences used for expression analysis is shown in Supplemental Table S4. 494

495

Determination of physiological and photosynthetic parameters 496

Various physiological parameters were analysed to determine the effect of drought 497

stress on Scarlett and the IL S42IL-143. For this purpose, a pot experiment was 498

conducted in a climate chamber with a 12h/12h light/dark photoperiod at 22±2 °C 499

with 50-60% relative humidity. The seeds of S42IL-143 were sown in 10 replications 500

each for control and treatment blocks in 1.2 L pots (10 × 10 × 12 cm) in a completely 501

randomized design. Drought stress treatment was performed at the three-leaf stage 502



16

(10 days after germination) by eliminating the water supply completely. The treated 503

pots were kept under stress for 3, 6 and 9 days. For all sensor measurements, the 504

fully expanded third leaf was analysed non-destructively to detect the moisture 505

content of plant tissue (leaves) and parameters affecting photosynthetic activity. The 506

EMISENS dual mode cavity microwave resonator (EMISENS GmbH, Jülich, 507

Germany) was used to non-destructively estimate the water status of barley leaves. 508

During the assessment of a leaf with the microwave resonator, the change of the 509

resonant frequency (fr) with respect to the empty resonator was recorded. As 510

described previously by Dadshani et al. (2015), the microwave sensor parameter 511

FRS, which is the negative relative frequency shift of fr, is highly correlated with the 512

water content in tested plant material. Five measurements were taken from each 513

leaf. The infra-red gas exchange analyser (LI-6400 XT, LICOR Inc., Lincoln, NE, 514

USA) was used to measure the photosynthetic parameters, namely stomatal 515

conductance (gs), transpiration rate (E), intercellular CO2 concentration (Ci) and 516

photosynthesis rate (A). To take continuous measurements, the centre of the third 517

leaf attached to the sensor was positioned in a leaf chamber. 518

519

Grain yield evaluation of Scarlett and S42IL-143 under drought stress 520

Scarlett and S42IL-143 seeds were sown in a pot (22 x 22 x26) containing a mixture 521

of topsoil, silica sand, milled lava and peat dust (Terrasoil®, Cordel & Sohn, Salm, 522

Germany). The experiment was conducted in a randomized complete block design 523

with five replications for each genotype per treatment. Plants were watered three 524

times a day using a drip irrigation system (Netafilm, Adelaide, Australia). Two 525

drought stress treatments were applied, at tillering stage and before heading. Water 526

supply was withheld for two weeks and the pots were re-watered. Matured panicles 527

and straw were harvested and oven dried at 37°C for 72 hours. Grain weight per 528

plant was evaluated under control and drought conditions. 529

530

Accession Numbers 531

P5cs1: Gene ID (HORVU1Hr1G072780), Protein ID (A0A287G756) 532

533

Supplemental Data 534

The following supplemental materials are available. 535



17

Supplemental Figure S1. Variation in proline accumulation in the S42IL population 536

under control and drought stress conditions. 537

Supplemental Figure S2. Confirmation of common wild barley introgression in 538

selected ILs. 539

Supplemental Figure S3. Segregation of QTL alleles for proline accumulation in the 540

S42IL-143-HR population. 541

Supplemental Figure S4. Variation in proline accumulation in the S42IL-143-HR 542

population under drought stress conditions. 543

Supplemental Figure S5. Transfection efficiency in Arabidopsis protoplasts. 544

Supplemental Figure S6. Gas exchange parameters of Scarlett and S42IL-143 545

under control and drought stress conditions. 546

Supplemental Table S1. Primers and sequences of KASP markers for fine mapping. 547

Supplemental Table S2. Primers used for positional cloning of P5cs1. 548

Supplemental Table S3. Primers used for expression analysis and sequencing. 549

Supplemental Table S4. Primers used for transient expression assays. 550

551

Acknowledgements 552

We thank Dr. Muhammad Ilyas for the guidelines in the protoplast transient 553

expression assay; Mrs. Karin Woitol, Mr. Süleyman Gunal and Ms. Annika Kortz for 554

providing valuable support during phenotyping and genotyping; Prof. Michael Frei, 555

Ms. Inci Vogt and Ms. Anna Backhaus for reading the manuscript. We are grateful to 556

Prof. Dr. Yamaguchi-Shinozaki for providing seeds of the abf quadruple mutant. 557

558

Funding information 559

The PhD scholarship of Mrs. Shumaila Muzammil was supported by the Higher 560

Education Commission of Pakistan. Mr. Asis Shrestha was supported by the 561

graduate college (GRK 2064) grant from the German Research Society (DFG). 562

563

Conflict of interest 564

The authors declare no conflict of interest. 565



18

Figure Legends 566

Fig. 1. Genetic mapping and validation of major QTLs for proline accumulation. 567

(A) Circos plot showing the genetic map of four selected wild barley introgression 568

lines carrying ISR42-8 and Scarlett alleles at the QTL region on chromosome 1H. (B) 569

Quantification of proline QTL QPro.S42-1H in four introgression lines. Bars represent 570

the mean ± standard error (n=5). Different letters indicate significant difference of 571

genotypes and prime show differences between control and drought stress (p<0.05) 572

using Tukey’s HSD test.Pr (C) Free proline reaction with ninhydrin. A darker color 573

indicates more proline accumulation in the samples. 574

Fig. 2. Positional cloning of the major QTL QPro.S42-1H. (A) Chromosomal map 575

of wild barley introgression lines S42IL-141 and S42IL-143 overlapping at the QTL 576

region. (B) Fine mapping of the QTL region using high-resolution segregating 577

population S42IL-143HR. The refined QTL interval represents an approximately 178 578

kb region between the M-L and M-R harbouring a single high confidence gene, 579

P5cs1. The numbers 1 and 2 represent a low confidence gene and a putative 580

transposon element having no functional annotation, respectively. The physical 581

positions are according to Morex assembly HV_IBSC_PGSB_v2. (C) Comparison of 582

genotype and phenotype data among the recombinants segregating at the targeted 583

QTL interval. The cultivated, wild and heterozygous alleles are represented with 584

letters C, W and H, respectively. n=number of recombinants. Bars represent the 585

mean ± standard error (n=5) (D) Coding sequence of P5cs1 showing mutations 586

between ISR42-8 and Scarlett. Indicated SNPs represent substitutions from ISR42-8 587

to Scarlett. Black triangle represents 44 bp insertion in the 3´UTR of Scarlett. Marker 588

positions upstream and downstream of ATG are indicated by – and +, respectively. 589

Fig. 3. Expression analyses of P5cs1 and proline accumulation. (A) 590

Quantification of mRNA levels in leaves of Scarlett and S42IL-143 under control and 591

drought stress conditions via RT-qPCR. The numbers on the x-axis represent days 592

after stress (DAS). (B) Proline accumulation in leaves of Scarlett and S42IL-143 593

under control and drought stress conditions. Bars represent the mean ± standard 594

error (n=3). Asterisks indicate significance difference between control and drought 595

(*p<0.05, **p<0.01) using pair-wise t-tests. 596

Fig. 4. Promoter sequence analysis. P5cs1 promoter sequence alignment between 597

wild barley ISR42-8 and cultivar Scarlett. SNP mutations are indicated in red bold 598

letters. Core-sequence of DNA motifs are underlined with bold letters. ABRE 599

(abscisic acid-responsive element), CE3 (Coupling element 3). 600

Fig. 5. P5cs1 promoter activity analysis in Arabidopsis protoplasts upon ABA 601

treatment. (A) Relative expression of GUS, ABF1, ABF2, ABF3 and ABF4 in 602

Arabidopsis Col-0 protoplasts transfected with P5cs1 promoter::reporter constructs of 603

ISR42-8 (pISR::eGFP-GUS) and Scarlett (pSCA::eGFP-GUS). For untreated 604

samples (-ABA), data represent relative expression of the indicated genes with the 605

value of pISR::eGFP-GUS (Col-0) set to 1. For treated samples (+ABA), data 606



19

represent relative expression of the indicated genes with the value of untreated 607

protoplasts set to 1. Bars represent the mean ± standard error (n=3). Asterisks 608

indicate significance difference between pISR (pISR::eGFP-GUS) and pSCA 609

(pSCA::eGFP-GUS) (**p<0.01) using pair-wise t-tests. (B) GUS activity of 610

pISR::eGFP-GUS in Arabidopsis mesophyll protoplasts of Col-0 and 611

abf1abf2abf3abf4 quadruple mutant. Bars represent the mean ± standard error (n=3). 612

Asterisks indicate significance difference between genotypes under –ABA (control) 613

and +ABA (**p<0.01, ***p<0.001) using pair-wise t-tests. 614

Fig. 6. Evaluation of physiological parameters in Scarlett and S42IL-143. (A-B) 615

Comparison of photosynthetic rate (A) in Scarlett and S42IL-143 under control and 616

different drought stress levels (0, 3, 6, 9 days after stress). (C-D) Effective quantum 617

yield of photosystem II (YII) in Scarlett and S42IL-143 under control and different 618

drought stress levels (0, 3, 6, 9 days after stress. (E) Resonance frequency shift 619

(FRS) value of Scarlett and S42IL-143 relative to control at different drought stress 620

levels (0, 3, 6, 9 days after stress). (F) Grain yield per plant in Scarlett and S42IL-143 621

under control and drought stress conditions. Data points and bars represent the 622

mean ± standard error (n=5). Asterisks indicate significance difference (*p<0.05, 623

**p<0.01) using pair-wise t-tests. 624



20

References 625

Ashraf M, Foolad M (2007) Roles of glycine betaine and proline in improving plant abiotic stress 626 resistance. Environmental and Experimental Botany 59: 206-216 627

Bates L, Waldren R, Teare I (1973) Rapid determination of free proline for water-stress studies. Plant 628 and Soil 39: 205-207 629

Benešová M, Holá D, Fischer L, Jedelský PL, Hnilička F, Wilhelmová N, Rothová O, Kočová M, 630 Procházková D, Honnerová J (2012) The physiology and proteomics of drought tolerance in 631 maize: early stomatal closure as a cause of lower tolerance to short-term dehydration? PLoS 632 One 7: e38017 633

Blum A (2017) Osmotic adjustment is a prime drought stress adaptive engine in support of plant 634 production. Plant, cCell & Environment 40: 4-10 635

Brestic M, Zivcak M (2013) PSII fluorescence techniques for measurement of drought and high 636 temperature stress signal in crop plants: protocols and applications. In Molecular Stress 637 Physiology of Plants. Springer, pp87-131 638

Chaves M, Flexas J, Pinheiro C (2009) Photosynthesis under drought and salt stress: regulation 639 mechanisms from whole plant to cell. Annals of Botany 103: 551-560 640

Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA-responsive element binding factors. 641 Journal of Biological Chemistry 275: 1723-1730 642

Dadshani S, Kurakin A, Amanov S, Hein B, Rongen H, Cranstone S, Blievernicht U, Menzel E, Léon J, 643 Klein N (2015) Non-invasive assessment of leaf water status using a dual-mode microwave 644 resonator. Plant Methods 11: 8 645

Dunnett CW (1955) A Multiple comparison procedure for comparing several treatments with a 646 control. Journal of the American Statistical Association 50: 1096-1121 647

Ellenberger T (1994) Getting a grip on DNA recognition: structures of the basic region leucine zipper, 648 and the basic region helix-loop-helix DNA-binding domains. Current Opinion in Structural 649 Biology 4: 12-21 650

Fujita Y, Fujita M, Shinozaki K, Yamaguchi-Shinozaki K (2011) ABA-mediated transcriptional 651 regulation in response to osmotic stress in plants. Journal of Plant Research 124: 509-525 652

Fujita Y, Yoshida T, Yamaguchi‐Shinozaki K (2013) Pivotal role of the AREB/ABF‐SnRK2 pathway in 653 ABRE‐mediated transcription in response to osmotic stress in plants. Physiologia Plantarum 654 147: 15-27 655

Graham LE (1993) Origin of land plants. John Wiley & Sons, Inc. 656 Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) 657

database:1999. Nucleic Acids Research 27: 297-300 658 Hobo T, Asada M, Kowyama Y, Hattori T (1999) ACGT‐containing abscisic acid response element 659

(ABRE) and coupling element 3 (CE3) are functionally equivalent. The Plant Journal 19: 679-660 689 661

Honsdorf N, March TJ, Hecht A, Eglinton J, Pillen K (2014) Evaluation of juvenile drought stress 662 tolerance and genotyping by sequencing with wild barley introgression lines. Molecular 663 Breeding 34: 1475-1495 664

Hossain MM, Lam HM, Zhang J (2015) Responses in gas exchange and water status between 665 drought-tolerant and-susceptible soybean genotypes with ABA application. The Crop Journal 666 3: 500-506 667

Hu C, Delauney AJ, Verma D (1992) A bifunctional enzyme (delta 1-pyrroline-5-carboxylate 668 synthetase) catalyzes the first two steps in proline biosynthesis in plants. Proceedings of the 669 National Academy of Sciences 89: 9354-9358 670

Hurst H (1995) Transcription factors 1: bZIP proteins. Protein Profile 2. 101-168 671 Karimi M, De Meyer B, Hilson P (2005) Modular cloning and expression of tagged fluorescent protein 672

in plant cells. Trends in Plant Science 10: 103-105 673 Katoh K, Misawa K, Kuma Ki, Miyata T (2002) MAFFT: a novel method for rapid multiple sequence 674

alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059-3066 675



21

Kesari R, Lasky JR, Villamor JG, Des Marais DL, Chen YJ, Liu TW, Lin W, Juenger TE, Verslues PE 676 (2012) Intron-mediated alternative splicing of Arabidopsis P5CS1 and its association with 677 natural variation in proline and climate adaptation. Proceedings of the National Academy of 678 Sciences 109: 9197-9202 679

Kishor PK, Sangam S, Amrutha R, Laxmi PS, Naidu K, Rao K, Rao S, Reddy K, Theriappan P, 680 Sreenivasulu N (2005) Regulation of proline biosynthesis, degradation, uptake and transport 681 in higher plants: its implications in plant growth and abiotic stress tolerance. Current Science 682 88: 424-438 683

Lancashire PD, Bleiholder H, Boom T, Langelüddeke P, Stauss R, Weber E, Witzenberger A (1991) A 684 uniform decimal code for growth stages of crops and weeds. Annals of Applied Biology 119: 685 561-601 686

Lawlor DW, Tezara W (2009) Causes of decreased photosynthetic rate and metabolic capacity in 687 water-deficient leaf cells: a critical evaluation of mechanisms and integration of processes. 688 Annals of botany 103: 561-579 689

Liang X, Zhang L, Natarajan SK, Becker DF (2013) Proline mechanisms of stress survival. Antioxidants 690 & Redox Signaling 19: 998-1011 691

Liu Y, Zhang X, Tran H, Shan L, Kim J, Childs K, Ervin EH, Frazier T, Zhao B (2015) Assessment of 692 drought tolerance of 49 switchgrass (Panicum virgatum) genotypes using physiological and 693 morphological parameters. Biotechnology for Biofuels 8: 152 694

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative 695 PCR and the 2− ΔΔCT method. methods 25: 402-408 696

Mendy B, Wang’ombe MW, Radakovic ZS, Holbein J, Ilyas M, Chopra D, Holton N, Zipfel C, Grundler 697 FM, Siddique S (2017) Arabidopsis leucine-rich repeat receptor–like kinase NILR1 is required 698 for induction of innate immunity to parasitic nematodes. PLoS Pathogens 13: e1006284 699

Naz AA, Arifuzzaman M, Muzammil S, Pillen K, Léon J (2014) Wild barley introgression lines revealed 700 novel QTL alleles for root and related shoot traits in the cultivated barley (Hordeum vulgare 701 L.). BMC genetics 15: 107 702

Ovcharenko I, Loots GG, Giardine BM, Hou M, Ma J, Hardison RC, Stubbs L, Miller W (2005) Mulan: 703 multiple-sequence local alignment and visualization for studying function and evolution. 704 Genome Research 15: 184-194 705

Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT–PCR. Nucleic 706 Acids Research 29: e45-e45 707

Rascher U, Liebig M, Lüttge U (2000) Evaluation of instant light‐response curves of chlorophyll 708 fluorescence parameters obtained with a portable chlorophyll fluorometer on site in the 709 field. Plant, Cell & Environment 23: 1397-1405 710

Riley T, Sontag E, Chen P, Levine A (2008) Transcriptional control of human p53-regulated genes. 711 Nature Reviews Molecular Cell Biology 9: 402-412 712

Schmalenbach I, Korber N, Pillen K (2008) Selecting a set of wild barley introgression lines and 713 verification of QTL effects for resistance to powdery mildew and leaf rust. Theoretical and 714 Applied Genetics 117: 1093-1106 715

Schmalenbach I, March TJ, Bringezu T, Waugh R, Pillen K (2011) High-resolution genotyping of wild 716 barley introgression lines and fine-mapping of the threshability locus thresh-1 using the 717 Illumina GoldenGate assay. G3: Genes, Genomes, Genetics 1: 187-196 718

Schulze-Lefert P, Dangl JL, Becker-Andre M, Hahlbrock K, Schulz W (1989) Inducible in vivo DNA 719 footprints define sequences necessary for UV light activation of the parsley chalcone 720 synthase gene. The EMBO Journal 8: 651 721

Shah SJ, Anjam MS, Mendy B, Anwer MA, Habash SS, Lozano-Torres JL, Grundler FM, Siddique S, 722 Hancock R (2017) Damage-associated responses of the host contribute to defence against 723 cyst nematodes but not root-knot nematodes. Journal of Experimental Botany 724

Shen Q, Zhang P, Ho T (1996) Modular nature of abscisic acid (ABA) response complexes: composite 725 promoter units that are necessary and sufficient for ABA induction of gene expression in 726 barley. The Plant Cell 8: 1107-1119 727



22

Souza R, Machado E, Silva J, Lagôa A, Silveira J (2004) Photosynthetic gas exchange, chlorophyll 728 fluorescence and some associated metabolic changes in cowpea (Vigna unguiculata) during 729 water stress and recovery. Environmental and Experimental Botany 51: 45-56 730

Strizhov N, Ábrahám E, Ökrész L, Blickling S, Zilberstein A, Schell J, Koncz C, Szabados L (1997) 731 Differential expression of two P5CS genes controlling proline accumulation during salt‐stress 732 requires ABA and is regulated by ABA1, ABI1 and AXR2 in Arabidopsis. The Plant Journal 12: 733 557-569 734

Szabados L, Savoure A (2010) Proline: a multifunctional amino acid. Trends in Plant Science 15: 89-97 735 Székely G, Ábrahám E, Cséplő Á, Rigó G, Zsigmond L, Csiszár J, Ayaydin F, Strizhov N, Jásik J, 736

Schmelzer E (2008) Duplicated P5CS genes of Arabidopsis play distinct roles in stress 737 regulation and developmental control of proline biosynthesis. The Plant Journal 53: 11-28 738

Szoke A, Miao G-H, Hong Z, Verma DPS (1992) Subcellular location of Δ 1-pyrroline-5-carboxylate 739 reductase in root/nodule and leaf of soybean. Plant Physiology 99: 1642-1649 740

Toniatti C, Demartis A, Monaci P, Nicosia A, Ciliberto G (1990) Synergistic trans-activation of the 741 human C-reactive protein promoter by transcription factor HNF-1 binding at two distinct 742 sites. The EMBO Journal 9: 4467 743

Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K, Yamaguchi-Shinozaki K (2000) Arabidopsis basic 744 leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction 745 pathway under drought and high-salinity conditions. Proceedings of the National Academy of 746 Sciences 97: 11632-11637 747

Verbruggen N, Villarroel R, Van Montagu M (1993) Osmoregulation of a pyrroline-5-carboxylate 748 reductase gene in Arabidopsis thaliana. Plant Physiology 103: 771-781 749

Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for 750 transient gene expression analysis. Nature protocols 2: 1565-1572 751

Yoshida R, Hobo T, Ichimura K, Mizoguchi T, Takahashi F, Aronso J, Ecker JR, Shinozaki K (2002) 752 ABA-activated SnRK2 protein kinase is required for dehydration stress signaling in 753 Arabidopsis. Plant and Cell Physiology 43: 1473-1483 754

Yoshida T, Fujita Y, Maruyama K, Mogami J, Todaka D, Shinozaki K, Yamaguchi‐Shinozaki K (2015) 755 Four Arabidopsis AREB/ABF transcription factors function predominantly in gene expression 756 downstream of SnRK2 kinases in abscisic acid signalling in response to osmotic stress. Plant, 757 Cell & Environment 38: 35-49 758

Yoshida T, Fujita Y, Sayama H, Kidokoro S, Maruyama K, Mizoi J, Shinozaki K, Yamaguchi‐Shinozaki 759 K (2010) AREB1, AREB2, and ABF3 are master transcription factors that cooperatively 760 regulate ABRE‐dependent ABA signaling involved in drought stress tolerance and require ABA 761 for full activation. The Plant Journal 61: 672-685 762

Yuan X, Yang Z, Li Y, Liu Q, Han W (2016) Effects of different levels of water stress on leaf 763 photosynthetic characteristics and antioxidant enzyme activities of greenhouse tomato. 764 Photosynthetica 54: 28-39 765

766



D

A B C

S42IL-143 (High proline) S42IL-141 (High proline) S42IL-130 (Low proline) S42IL-133 (Low proline)

C Stress Control

S42

IL-1

43

Sca

rlett

S42

IL-1

41

Fig. 1.

B

A

a a a

a‘ a‘ a‘ b b b

b‘ b‘ b‘

Genotype *** Treatment *** Interaction ***



S42IL-143

S42IL-141

KASP-L (495,202,492 bp)

KASP-R (500,582,670 bp)

S42IL-143-HR (BC4S2, 3300 plants)

Proline [µg/g] 0 1000 2000 3000 4000 C

A

B 3772.982 kb

D

ISR42-8 W W W W W W

R1 H H H W W W R2 C W W W H H R3 H H H W W W R4 W W W W H H R5 C W W W H H R6 C C C H H H R7 C C C H H H R8 C C C H H W R9 C C C H H H

R10 C C C C H H R11 C C C C H H R12 C C . C H H

Scarlett C C C C C C

TGA ATG

A/G H→R

+1745 +1

C/T

C/A

C

/T

+100

6

+215

1

KASP-R M-R KASP-L

M-R M-L

M-L

M-P5cs1-Cd M-P5cs1-Pro

1427.350 kb

5´ 3´ -500

+215

4

n:7 n:6 n:6 n:6 n:0 n:9

+933

+119

4

178.376 kb

P5cs1

1.6 cM

1 2



Fig. 3

A B



CATAAGTCGTCTTTGACACGCGCCATGCGTTTGATGGGCCTCTGAGCCGCTTATCTCTCTCTCTCTTCCTTACCCTTTCCTTTCCTTATCTTTTTCCTATAAAAGCGTTGAGCCGCTCGTTC

CATAAGTCGTCTTTGACACGCGCCATGCGTTCGATGGGCCTCCGAGCCGCTTATCTCTCTCTCT--TCCTTATCCTTTCCTTTCCTTATCTTTTTCCTATAAAAGCGTTGAGCCGCTCGTTC

TTCTCCTTCTTTTTTTTCTTCGCGCGACACATCACACCCATGGGAGCACCATCCCTCATCGTCGTAGACCGGTGCACTGCCGTCGCGGCTCGTGTTGCTCCGACGTCTGCCCCTACATGTTCTCCTTCTTTTTCTTCTTCGCGCGACACATCACACCCATGGGAGCACCATCCCTCATCGTCGTAGACCGGTGCACTGCCGCCGCCGCTTGTGTTGCTCCGACGTCTGCCCCTACACG

CCACGCTCTACATCGTTGCTGCAAACCGCCGTCGCCTCGCGTCGCACCACCGCAGCTCCTGCGAAGCAGTTTGTGTCGTCGTCGCCGCGCTCCGCATCAAAGTTTTT-GCCATGGCCGCCACGCCCTACATCGTTGCTGCAAACCGCCGCCGCCTCGCGTCGCACCGCCGCAGCTCCTGCAAAGCAGTTTGTGTCGTCGTCGCCGCGCTCTGCATCAAAGTTTTTTGCCATGGCCG

TCGCATGCTGCATCCCAACATCCGCCTTCATCGACGACACTGCTGCAATGGAACGCACTGAGAGCTGCAATGGAGTGCCGCCAAGGTCGTTGGAGCTCCGTTGCGGCTCCATTGGAGCTCGCATGCTGCATCCCAACATCCGCCTTCATCGACGACACTGCTGCAATGGAACGCACCGAGAGCTGCAATGGAGTGCCGCCAAGGTCGTTGGAGCTTCGTTGCGGCTCCATTGGAGC

TTAACCAGAGCTGCAATGGAATGCCGTCGGAGTTGCAATGGAGCTTCACCGACGGCTCTAGGGAGGGGTGAGGGTGGGAGGAGCTTTTGGTGTTGCATTGGAGCTCTCGTCGTCGGCTTAACCAGAGCTGCAATGGAATGCCGTCGGAGTTGCAATGGAGCTTCACCGACGGCTCTAGGGAGGGGTGAGGGTGGGAGGAGCTTTTGGTGTTGCATTGGAGCGCTCGCCGTCGGC

TCCATTGCAGCTCCACCGGAACGATCACCGGTTACTAGACATAGCGGATGGTGTTACTATGAAGCTCTCGTCATGATTGCTCTTCGATGCCGTAATGGATGTTCGCCGGGGACTTGCGTTCCATTGCAGCTCCACCGGAACGATCACCGGTTACTAGACATAGCGTATGGTGTTACTATGAAGCTCTCGTCATGATTGCTCTTCGATGCCGTAATGGATGTTCGCCGGGGACTTGCGT

GCTCGAAATCGAAGTAGGTGGGTTGATTGCATGCACGCGAGAGGAATGCGTCATCACACATTTAAGTATCTAAGGGTCGGAAAGAATTGATCAGACGGCTAGCGACCCGATTGATTTGGGCTCGAAATCGAAGTAGGTGGGTTGATTGGATGCACGCGAGAGGAATGCGTCATCACACATTTAAGTATCTAAGGGTCGGAAAGAATTGATCAGACGGCTAGCGACCCGATTGATTTCG

CTAGAAAATCAGTCGGATGATCAATAGTAGCCGCGAGGAAAAACCGTTTTCTTGCCGTCCCTCTCCGAAGCGACGTTCGCCGGATAACATCTTGGTTCGATCGTTCGACTTGACTCAGCCTAGAAAATCAGTCGGATGATCAATAGTAGCCGCGAGGAAAAACCGTTTTCTTGCCGTCCCTCTCCGAAGCGACGTTCGCCGGATAACATCTTGGTTCGATCGTTCGACTTGACTCAGC

TCGTTCCGTGAGGCGACACACGTTTCGGTTCCCCCGTGTGAGGTGTCGTCTTTTTTTTTTTTTTTTTT----GAGATGGTGTCAGGTGTCGGCTCTAACCTGAAGCCCGAAGATGGAAGTCGTTCCGTGAGGCGACACACGTTTCGGTTCCCCCGTGTGAGGTGTCGTCTTTTTTTTTTTTTTTTTTTTTTGAGATGGTGTCAGGTGTCGACTCTAACCTGAAGCCCGAAGGTGGAAG

CAAAAAACGGACCAGACAGATATACATACACTCCAGGAGATGTACGCCACGCCGTCTCAGTATCCATATATTGATATATATCCATCTCAGAGCACGTCAGCGGCCTACCAACCCTATTGCAAAAAACGGACCAGACAGATATACATACACTCCAGGAGATGTACGCCACGCCGTCTCAGTATCCATATATTGATATATATCCATCTCAGAGCACGTCAGCGGCCTACCAACCCTATTG

TACGTGCTGTGCGTGTATCGTGCGCTCCATCTCACGAGGGGTCGATCGGACGGCCAGCGTCCCCGCGCCTCCTCCTCCGTGGAAGGCGGGTGACGCGCACGCCAACGGGACACGATACGTGCTGTGCGTGTATCGTGCGCTCCATCTCACGAGGGGTCGATCGGACGGCCAGCGTCCCCGCGCCTCCTCCTCCGTGGAAGGCGGGTGACGCGCACGCCAACGGGACACGA

CACGGGGTGGTGGTGGCGGCGGCGGCGGCGGACGCAGAGGATCACGGGGTTCGTTGGCGAGCCGCTGGGGTTTCGCTCACGGAACCAAGCACCAACCCCTCACCCCTTTAAAACCCACGGGGTGGTGGTGGCGGCGGCGGCGGCGGACGCAGAGGATCACGGGGTTCGTTGGCGAGCCGCTGGGGTTTCGCTCACGGAACCAAGCACCAACCCCTCACCCCTTTAAAACC

GCTCGGCTCTATCCCTCTCCTCTCTCTCTGACCTCCCCACACATCGCGGGTGCGGCGACGAGGGCGACGGAAAAAAAACACCGCTGATAAGAGAGAGGCGGCGCGCCGAGCCTGCCGCTCGGCTCTATCCCTCTCCTCTCTCTCTGACCTCCCCACACATCGCGGGTGCGGCGACGAGGCGACGGGAAAAAAAACACCGCAGATAAGAGAGAGGCGGCGCGCCGAGCCTGCC

CGCGGCCATGCGCGGCCATG

ISR42-8Scarlett -1542

-1420

-1301

-1183

-1065

-948

-829

-710

-591

-472

-353

-238

-123

-7

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

ISR42-8Scarlett

CE3

ABRE

ORF

CE3ABRE

CE3

Fig. 4



Fig. 5.

A

**

B



Scarlett S42IL-143

Fig. 6.

A

C

B

D

F E

A A



Parsed CitationsAshraf M, Foolad M (2007) Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environmental andExperimental Botany 59: 206-216

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bates L, Waldren R, Teare I (1973) Rapid determination of free proline for water-stress studies. Plant and Soil 39: 205-207Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Benešová M, Holá D, Fischer L, Jedelský PL, Hnilička F, Wilhelmová N, Rothová O, Kočová M, Procházková D, Honnerová J (2012) Thephysiology and proteomics of drought tolerance in maize: early stomatal closure as a cause of lower tolerance to short-termdehydration? PLoS One 7: e38017

Blum A (2017) Osmotic adjustment is a prime drought stress adaptive engine in support of plant production. Plant, cCell &Environment 40: 4-10


Brestic M, Zivcak M (2013) PSII fluorescence techniques for measurement of drought and high temperature stress signal in cropplants: protocols and applications. In Molecular Stress Physiology of Plants. Springer, pp87-131


Chaves M, Flexas J, Pinheiro C (2009) Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell.Annals of Botany 103: 551-560


Choi H, Hong J, Ha J, Kang J, Kim SY (2000) ABFs, a family of ABA-responsive element binding factors. Journal of Biological Chemistry275: 1723-1730


Dadshani S, Kurakin A, Amanov S, Hein B, Rongen H, Cranstone S, Blievernicht U, Menzel E, Léon J, Klein N (2015) Non-invasiveassessment of leaf water status using a dual-mode microwave resonator. Plant Methods 11: 8


Dunnett CW (1955) A Multiple comparison procedure for comparing several treatments with a control. Journal of the AmericanStatistical Association 50: 1096-1121


Ellenberger T (1994) Getting a grip on DNA recognition: structures of the basic region leucine zipper, and the basic region helix-loop-helix DNA-binding domains. Current Opinion in Structural Biology 4: 12-21


Fujita Y, Fujita M, Shinozaki K, Yamaguchi-Shinozaki K (2011) ABA-mediated transcriptional regulation in response to osmotic stress inplants. Journal of Plant Research 124: 509-525


Fujita Y, Yoshida T, Yamaguchi‐Shinozaki K (2013) Pivotal role of the AREB/ABF‐SnRK2 pathway in ABRE‐mediated transcription inresponse to osmotic stress in plants. Physiologia Plantarum 147: 15-27


Graham LE (1993) Origin of land plants. John Wiley & Sons, Inc.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA elements (PLACE) database:1999. Nucleic AcidsResearch 27: 297-300


Hobo T, Asada M, Kowyama Y, Hattori T (1999) ACGT‐containing abscisic acid response element (ABRE) and coupling element 3 (CE3)are functionally equivalent. The Plant Journal 19: 679-689



http://www.ncbi.nlm.nih.gov/pubmed?term=Ashraf M%2C Foolad M %282007%29 Roles of glycine betaine and proline in improving plant abiotic stress resistance%2E Environmental and Experimental Botany 59%3A 206%2D216&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ashraf&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Roles of glycine betaine and proline in improving plant abiotic stress resistance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Roles of glycine betaine and proline in improving plant abiotic stress resistance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ashraf&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bates L%2C Waldren R%2C Teare I %281973%29 Rapid determination of free proline for water%2Dstress studies%2E Plant and Soil 39%3A 205%2D207&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bates&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Rapid determination of free proline for water-stress studies&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Rapid determination of free proline for water-stress studies&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bates&as_ylo=1973&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Blum A %282017%29 Osmotic adjustment is a prime drought stress adaptive engine in support of plant production%2E Plant%2C cCell %26 Environment 40%3A 4%2D10&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Blum&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Osmotic adjustment is a prime drought stress adaptive engine in support of plant production&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Osmotic adjustment is a prime drought stress adaptive engine in support of plant production&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Blum&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Brestic M%2C Zivcak M %282013%29 PSII fluorescence techniques for measurement of drought and high temperature stress signal in crop plants%3A protocols and applications%2E In Molecular Stress Physiology of Plants%2E Springer%2C pp87%2D131&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Brestic&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=PSII fluorescence techniques for measurement of drought and high temperature stress signal in crop plants: protocols and applications.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=PSII fluorescence techniques for measurement of drought and high temperature stress signal in crop plants: protocols and applications.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Brestic&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Chaves M%2C Flexas J%2C Pinheiro C %282009%29 Photosynthesis under drought and salt stress%3A regulation mechanisms from whole plant to cell%2E Annals of Botany 103%3A 551%2D560&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chaves&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chaves&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Choi H%2C Hong J%2C Ha J%2C Kang J%2C Kim SY %282000%29 ABFs%2C a family of ABA%2Dresponsive element binding factors%2E Journal of Biological Chemistry 275%3A 1723%2D1730&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Choi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABFs, a family of ABA-responsive element binding factors&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABFs, a family of ABA-responsive element binding factors&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Choi&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Dadshani S%2C Kurakin A%2C Amanov S%2C Hein B%2C Rongen H%2C Cranstone S%2C Blievernicht U%2C Menzel E%2C L�on J%2C Klein N %282015%29 Non%2Dinvasive assessment of leaf water status using a dual%2Dmode microwave resonator%2E Plant Methods 11%3A 8&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Dadshani&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Non-invasive assessment of leaf water status using a dual-mode microwave resonator.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Non-invasive assessment of leaf water status using a dual-mode microwave resonator.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Dadshani&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Dunnett CW %281955%29 A Multiple comparison procedure for comparing several treatments with a control%2E Journal of the American Statistical Association 50%3A 1096%2D1121&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Dunnett&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A Multiple comparison procedure for comparing several treatments with a control&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A Multiple comparison procedure for comparing several treatments with a control&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Dunnett&as_ylo=1955&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ellenberger T %281994%29 Getting a grip on DNA recognition%3A structures of the basic region leucine zipper%2C and the basic region helix%2Dloop%2Dhelix DNA%2Dbinding domains%2E Current Opinion in Structural Biology 4%3A 12%2D21&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ellenberger&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Getting a grip on DNA recognition: structures of the basic region leucine zipper, and the basic region helix-loop-helix DNA-binding domains&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Getting a grip on DNA recognition: structures of the basic region leucine zipper, and the basic region helix-loop-helix DNA-binding domains&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ellenberger&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fujita Y%2C Fujita M%2C Shinozaki K%2C Yamaguchi%2DShinozaki K %282011%29 ABA%2Dmediated transcriptional regulation in response to osmotic stress in plants%2E Journal of Plant Research 124%3A 509%2D525&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fujita&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABA-mediated transcriptional regulation in response to osmotic stress in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABA-mediated transcriptional regulation in response to osmotic stress in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fujita&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fujita Y%2C Yoshida T%2C Yamaguchi�?�Shinozaki K %282013%29 Pivotal role of the AREB%2FABF�?�SnRK2 pathway in ABRE�?�mediated transcription in response to osmotic stress in plants%2E Physiologia Plantarum 147%3A 15%2D27&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fujita&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Pivotal role of the AREB/ABFâ�?�SnRK2 pathway in ABREâ�?�mediated transcription in response to osmotic stress in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Pivotal role of the AREB/ABFâ�?�SnRK2 pathway in ABREâ�?�mediated transcription in response to osmotic stress in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fujita&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Graham LE %281993%29 Origin of land plants%2E John Wiley %26 Sons%2C Inc%2E&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Graham&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Origin of land plants.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Origin of land plants.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Graham&as_ylo=1993&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Higo K%2C Ugawa Y%2C Iwamoto M%2C Korenaga T %281999%29 Plant cis%2Dacting regulatory DNA elements %28PLACE%29 database%3A1999%2E Nucleic Acids Research 27%3A 297%2D300&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Higo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Plant cis-acting regulatory DNA elements (PLACE) database:1999&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Plant cis-acting regulatory DNA elements (PLACE) database:1999&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Higo&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hobo T%2C Asada M%2C Kowyama Y%2C Hattori T %281999%29 ACGT�?�containing abscisic acid response element %28ABRE%29 and coupling element 3 %28CE3%29 are functionally equivalent%2E The Plant Journal 19%3A 679%2D689&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hobo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ACGTâ�?�containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ACGTâ�?�containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hobo&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1


Honsdorf N, March TJ, Hecht A, Eglinton J, Pillen K (2014) Evaluation of juvenile drought stress tolerance and genotyping bysequencing with wild barley introgression lines. Molecular Breeding 34: 1475-1495


Hossain MM, Lam HM, Zhang J (2015) Responses in gas exchange and water status between drought-tolerant and-susceptiblesoybean genotypes with ABA application. The Crop Journal 3: 500-506


Hu C, Delauney AJ, Verma D (1992) A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps inproline biosynthesis in plants. Proceedings of the National Academy of Sciences 89: 9354-9358


Hurst H (1995) Transcription factors 1: bZIP proteins. Protein Profile 2. 101-168Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Karimi M, De Meyer B, Hilson P (2005) Modular cloning and expression of tagged fluorescent protein in plant cells. Trends in PlantScience 10: 103-105


Katoh K, Misawa K, Kuma Ki, Miyata T (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fouriertransform. Nucleic Acids Research 30: 3059-3066


Kesari R, Lasky JR, Villamor JG, Des Marais DL, Chen YJ, Liu TW, Lin W, Juenger TE, Verslues PE (2012) Intron-mediated alternativesplicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation. Proceedings of the NationalAcademy of Sciences 109: 9197-9202


Kishor PK, Sangam S, Amrutha R, Laxmi PS, Naidu K, Rao K, Rao S, Reddy K, Theriappan P, Sreenivasulu N (2005) Regulation ofproline biosynthesis, degradation, uptake and transport in higher plants: its implications in plant growth and abiotic stress tolerance.Current Science 88: 424-438


Lancashire PD, Bleiholder H, Boom T, Langelüddeke P, Stauss R, Weber E, Witzenberger A (1991) A uniform decimal code for growthstages of crops and weeds. Annals of Applied Biology 119: 561-601


Lawlor DW, Tezara W (2009) Causes of decreased photosynthetic rate and metabolic capacity in water-deficient leaf cells: a criticalevaluation of mechanisms and integration of processes. Annals of botany 103: 561-579


Liang X, Zhang L, Natarajan SK, Becker DF (2013) Proline mechanisms of stress survival. Antioxidants & Redox Signaling 19: 998-1011Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Liu Y, Zhang X, Tran H, Shan L, Kim J, Childs K, Ervin EH, Frazier T, Zhao B (2015) Assessment of drought tolerance of 49 switchgrass(Panicum virgatum) genotypes using physiological and morphological parameters. Biotechnology for Biofuels 8: 152


Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method.methods 25: 402-408


Mendy B, Wang'ombe MW, Radakovic ZS, Holbein J, Ilyas M, Chopra D, Holton N, Zipfel C, Grundler FM, Siddique S (2017) Arabidopsisleucine-rich repeat receptor–like kinase NILR1 is required for induction of innate immunity to parasitic nematodes. PLoS Pathogens13: e1006284


Naz AA, Arifuzzaman M, Muzammil S, Pillen K, Léon J (2014) Wild barley introgression lines revealed novel QTL alleles for root andrelated shoot traits in the cultivated barley (Hordeum vulgare L.). BMC genetics 15: 107

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon September 17, 2018 - Published by Downloaded from

Copyright © 2018 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Honsdorf N%2C March TJ%2C Hecht A%2C Eglinton J%2C Pillen K %282014%29 Evaluation of juvenile drought stress tolerance and genotyping by sequencing with wild barley introgression lines%2E Molecular Breeding 34%3A 1475%2D1495&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Honsdorf&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Evaluation of juvenile drought stress tolerance and genotyping by sequencing with wild barley introgression lines&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Evaluation of juvenile drought stress tolerance and genotyping by sequencing with wild barley introgression lines&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Honsdorf&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hossain MM%2C Lam HM%2C Zhang J %282015%29 Responses in gas exchange and water status between drought%2Dtolerant and%2Dsusceptible soybean genotypes with ABA application%2E The Crop Journal 3%3A 500%2D506&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hossain&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Responses in gas exchange and water status between drought-tolerant and-susceptible soybean genotypes with ABA application&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Responses in gas exchange and water status between drought-tolerant and-susceptible soybean genotypes with ABA application&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hossain&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hu C%2C Delauney AJ%2C Verma D %281992%29 A bifunctional enzyme %28delta 1%2Dpyrroline%2D5%2Dcarboxylate synthetase%29 catalyzes the first two steps in proline biosynthesis in plants%2E Proceedings of the National Academy of Sciences 89%3A 9354%2D9358&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A bifunctional enzyme (delta 1-pyrroline-5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hu&as_ylo=1992&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hurst H %281995%29 Transcription factors 1%3A bZIP proteins%2E Protein Profile 2%2E 101%2D168&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hurst&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hurst&as_ylo=1995&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Karimi M%2C De Meyer B%2C Hilson P %282005%29 Modular cloning and expression of tagged fluorescent protein in plant cells%2E Trends in Plant Science 10%3A 103%2D105&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Karimi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Modular cloning and expression of tagged fluorescent protein in plant cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Modular cloning and expression of tagged fluorescent protein in plant cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Karimi&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Katoh K%2C Misawa K%2C Kuma Ki%2C Miyata T %282002%29 MAFFT%3A a novel method for rapid multiple sequence alignment based on fast Fourier transform%2E Nucleic Acids Research 30%3A 3059%2D3066&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Katoh&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Katoh&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kesari R%2C Lasky JR%2C Villamor JG%2C Des Marais DL%2C Chen YJ%2C Liu TW%2C Lin W%2C Juenger TE%2C Verslues PE %282012%29 Intron%2Dmediated alternative splicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation%2E Proceedings of the National Academy of Sciences 109%3A 9197%2D9202&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kesari&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Intron-mediated alternative splicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Intron-mediated alternative splicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kesari&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kishor PK%2C Sangam S%2C Amrutha R%2C Laxmi PS%2C Naidu K%2C Rao K%2C Rao S%2C Reddy K%2C Theriappan P%2C Sreenivasulu N %282005%29 Regulation of proline biosynthesis%2C degradation%2C uptake and transport in higher plants%3A its implications in plant growth and abiotic stress tolerance%2E Current Science 88%3A 424%2D438&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kishor&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of proline biosynthesis, degradation, uptake and transport in higher plants: its implications in plant growth and abiotic stress tolerance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of proline biosynthesis, degradation, uptake and transport in higher plants: its implications in plant growth and abiotic stress tolerance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kishor&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lancashire PD%2C Bleiholder H%2C Boom T%2C Langel�ddeke P%2C Stauss R%2C Weber E%2C Witzenberger A %281991%29 A uniform decimal code for growth stages of crops and weeds%2E Annals of Applied Biology 119%3A 561%2D601&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lancashire&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A uniform decimal code for growth stages of crops and weeds&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A uniform decimal code for growth stages of crops and weeds&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lancashire&as_ylo=1991&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lawlor DW%2C Tezara W %282009%29 Causes of decreased photosynthetic rate and metabolic capacity in water%2Ddeficient leaf cells%3A a critical evaluation of mechanisms and integration of processes%2E Annals of botany 103%3A 561%2D579&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lawlor&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Causes of decreased photosynthetic rate and metabolic capacity in water-deficient leaf cells: a critical evaluation of mechanisms and integration of processes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Causes of decreased photosynthetic rate and metabolic capacity in water-deficient leaf cells: a critical evaluation of mechanisms and integration of processes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lawlor&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Liang X%2C Zhang L%2C Natarajan SK%2C Becker DF %282013%29 Proline mechanisms of stress survival%2E Antioxidants %26 Redox Signaling 19%3A 998%2D1011&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Proline mechanisms of stress survival&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Proline mechanisms of stress survival&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liang&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu Y%2C Zhang X%2C Tran H%2C Shan L%2C Kim J%2C Childs K%2C Ervin EH%2C Frazier T%2C Zhao B %282015%29 Assessment of drought tolerance of 49 switchgrass %28Panicum virgatum%29 genotypes using physiological and morphological parameters%2E Biotechnology for Biofuels 8%3A 152&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Assessment of drought tolerance of 49 switchgrass (Panicum virgatum) genotypes using physiological and morphological parameters.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Assessment of drought tolerance of 49 switchgrass (Panicum virgatum) genotypes using physiological and morphological parameters.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Livak KJ%2C Schmittgen TD %282001%29 Analysis of relative gene expression data using real%2Dtime quantitative PCR and the 2�?? �?�?CT method%2E methods 25%3A 402%2D408&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Livak&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Analysis of relative gene expression data using real-time quantitative PCR and the 2â�?�? �?�?�?�?CT method&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Analysis of relative gene expression data using real-time quantitative PCR and the 2â�?�? �?�?�?�?CT method&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Livak&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Mendy B%2C Wang%27ombe MW%2C Radakovic ZS%2C Holbein J%2C Ilyas M%2C Chopra D%2C Holton N%2C Zipfel C%2C Grundler FM%2C Siddique S %282017%29 Arabidopsis leucine%2Drich repeat receptor%26%23x2013%3Blike kinase NILR1 is required for induction of innate immunity to parasitic nematodes%2E PLoS Pathogens 13%3A e1006284&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mendy&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis leucine-rich repeat receptor?like kinase NILR1 is required for induction of innate immunity to parasitic nematodes.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis leucine-rich repeat receptor?like kinase NILR1 is required for induction of innate immunity to parasitic nematodes.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mendy&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Naz AA%2C Arifuzzaman M%2C Muzammil S%2C Pillen K%2C L�on J %282014%29 Wild barley introgression lines revealed novel QTL alleles for root and related shoot traits in the cultivated barley %28Hordeum vulgare L%2E%29%2E BMC genetics 15%3A 107&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Naz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Wild barley introgression lines revealed novel QTL alleles for root and related shoot traits in the cultivated barley (Hordeum vulgare L.).&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Wild barley introgression lines revealed novel QTL alleles for root and related shoot traits in the cultivated barley (Hordeum vulgare L.).&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Naz&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1


Google Scholar: Author Only Title Only Author and Title

Ovcharenko I, Loots GG, Giardine BM, Hou M, Ma J, Hardison RC, Stubbs L, Miller W (2005) Mulan: multiple-sequence local alignmentand visualization for studying function and evolution. Genome Research 15: 184-194


Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Research 29: e45-e45Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Rascher U, Liebig M, Lüttge U (2000) Evaluation of instant light‐response curves of chlorophyll fluorescence parameters obtained witha portable chlorophyll fluorometer on site in the field. Plant, Cell & Environment 23: 1397-1405


Riley T, Sontag E, Chen P, Levine A (2008) Transcriptional control of human p53-regulated genes. Nature Reviews Molecular CellBiology 9: 402-412


Schmalenbach I, Korber N, Pillen K (2008) Selecting a set of wild barley introgression lines and verification of QTL effects forresistance to powdery mildew and leaf rust. Theoretical and Applied Genetics 117: 1093-1106


Schmalenbach I, March TJ, Bringezu T, Waugh R, Pillen K (2011) High-resolution genotyping of wild barley introgression lines andfine-mapping of the threshability locus thresh-1 using the Illumina GoldenGate assay. G3: Genes, Genomes, Genetics 1: 187-196


Schulze-Lefert P, Dangl JL, Becker-Andre M, Hahlbrock K, Schulz W (1989) Inducible in vivo DNA footprints define sequencesnecessary for UV light activation of the parsley chalcone synthase gene. The EMBO Journal 8: 651


Shah SJ, Anjam MS, Mendy B, Anwer MA, Habash SS, Lozano-Torres JL, Grundler FM, Siddique S, Hancock R (2017) Damage-associated responses of the host contribute to defence against cyst nematodes but not root-knot nematodes. Journal of ExperimentalBotany


Shen Q, Zhang P, Ho T (1996) Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessaryand sufficient for ABA induction of gene expression in barley. The Plant Cell 8: 1107-1119


Souza R, Machado E, Silva J, Lagôa A, Silveira J (2004) Photosynthetic gas exchange, chlorophyll fluorescence and some associatedmetabolic changes in cowpea (Vigna unguiculata) during water stress and recovery. Environmental and Experimental Botany 51: 45-56


Strizhov N, Ábrahám E, Ökrész L, Blickling S, Zilberstein A, Schell J, Koncz C, Szabados L (1997) Differential expression of two P5CSgenes controlling proline accumulation during salt‐stress requires ABA and is regulated by ABA1, ABI1 and AXR2 in Arabidopsis. ThePlant Journal 12: 557-569


Szabados L, Savoure A (2010) Proline: a multifunctional amino acid. Trends in Plant Science 15: 89-97Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Székely G, Ábrahám E, Cséplő Á, Rigó G, Zsigmond L, Csiszár J, Ayaydin F, Strizhov N, Jásik J, Schmelzer E (2008) Duplicated P5CSgenes of Arabidopsis play distinct roles in stress regulation and developmental control of proline biosynthesis. The Plant Journal 53:11-28


Szoke A, Miao G-H, Hong Z, Verma DPS (1992) Subcellular location of Δ 1-pyrroline-5-carboxylate reductase in root/nodule and leaf ofsoybean. Plant Physiology 99: 1642-1649


Toniatti C, Demartis A, Monaci P, Nicosia A, Ciliberto G (1990) Synergistic trans-activation of the human C-reactive protein promoter bytranscription factor HNF-1 binding at two distinct sites. The EMBO Journal 9: 4467


http://www.ncbi.nlm.nih.gov/pubmed?term=Ovcharenko I%2C Loots GG%2C Giardine BM%2C Hou M%2C Ma J%2C Hardison RC%2C Stubbs L%2C Miller W %282005%29 Mulan%3A multiple%2Dsequence local alignment and visualization for studying function and evolution%2E Genome Research 15%3A 184%2D194&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ovcharenko&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mulan: multiple-sequence local alignment and visualization for studying function and evolution&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mulan: multiple-sequence local alignment and visualization for studying function and evolution&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ovcharenko&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Pfaffl MW %282001%29 A new mathematical model for relative quantification in real%2Dtime RT%26%23x2013%3BPCR%2E Nucleic Acids Research 29%3A e45%2De45&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pfaffl&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A new mathematical model for relative quantification in real-time RT?PCR&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A new mathematical model for relative quantification in real-time RT?PCR&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pfaffl&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Rascher U%2C Liebig M%2C Lüttge U %282000%29 Evaluation of instant light�?�response curves of chlorophyll fluorescence parameters obtained with a portable chlorophyll fluorometer on site in the field%2E Plant%2C Cell %26 Environment 23%3A 1397%2D1405&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rascher&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Evaluation of instant lightâ�?�response curves of chlorophyll fluorescence parameters obtained with a portable chlorophyll fluorometer on site in the field&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Evaluation of instant lightâ�?�response curves of chlorophyll fluorescence parameters obtained with a portable chlorophyll fluorometer on site in the field&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rascher&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Riley T%2C Sontag E%2C Chen P%2C Levine A %282008%29 Transcriptional control of human p53%2Dregulated genes%2E Nature Reviews Molecular Cell Biology 9%3A 402%2D412&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Riley&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional control of human p53-regulated genes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional control of human p53-regulated genes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Riley&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schmalenbach I%2C Korber N%2C Pillen K %282008%29 Selecting a set of wild barley introgression lines and verification of QTL effects for resistance to powdery mildew and leaf rust%2E Theoretical and Applied Genetics 117%3A 1093%2D1106&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schmalenbach&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Selecting a set of wild barley introgression lines and verification of QTL effects for resistance to powdery mildew and leaf rust&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Selecting a set of wild barley introgression lines and verification of QTL effects for resistance to powdery mildew and leaf rust&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schmalenbach&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schmalenbach I%2C March TJ%2C Bringezu T%2C Waugh R%2C Pillen K %282011%29 High%2Dresolution genotyping of wild barley introgression lines and fine%2Dmapping of the threshability locus thresh%2D1 using the Illumina GoldenGate assay%2E G3%3A Genes%2C Genomes%2C Genetics 1%3A 187%2D196&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schmalenbach&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=High-resolution genotyping of wild barley introgression lines and fine-mapping of the threshability locus thresh-1 using the Illumina GoldenGate assay&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=High-resolution genotyping of wild barley introgression lines and fine-mapping of the threshability locus thresh-1 using the Illumina GoldenGate assay&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schmalenbach&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schulze%2DLefert P%2C Dangl JL%2C Becker%2DAndre M%2C Hahlbrock K%2C Schulz W %281989%29 Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene%2E The EMBO Journal 8%3A 651&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schulze-Lefert&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schulze-Lefert&as_ylo=1989&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Shah SJ%2C Anjam MS%2C Mendy B%2C Anwer MA%2C Habash SS%2C Lozano%2DTorres JL%2C Grundler FM%2C Siddique S%2C Hancock R %282017%29 Damage%2Dassociated responses of the host contribute to defence against cyst nematodes but not root%2Dknot nematodes%2E Journal of Experimental Botany&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shah&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Damage-associated responses of the host contribute to defence against cyst nematodes but not root-knot nematodes.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Damage-associated responses of the host contribute to defence against cyst nematodes but not root-knot nematodes.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shah&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Shen Q%2C Zhang P%2C Ho T %281996%29 Modular nature of abscisic acid %28ABA%29 response complexes%3A composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley%2E The Plant Cell 8%3A 1107%2D1119&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Modular nature of abscisic acid (ABA) response complexes: composite promoter units that are necessary and sufficient for ABA induction of gene expression in barley&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shen&as_ylo=1996&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Souza R%2C Machado E%2C Silva J%2C Lag�a A%2C Silveira J %282004%29 Photosynthetic gas exchange%2C chlorophyll fluorescence and some associated metabolic changes in cowpea %28Vigna unguiculata%29 during water stress and recovery%2E Environmental and Experimental Botany 51%3A 45%2D56&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Souza&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Photosynthetic gas exchange, chlorophyll fluorescence and some associated metabolic changes in cowpea (Vigna unguiculata) during water stress and recovery&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Photosynthetic gas exchange, chlorophyll fluorescence and some associated metabolic changes in cowpea (Vigna unguiculata) during water stress and recovery&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Souza&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Strizhov N%2C Ábrahám E%2C �?krész L%2C Blickling S%2C Zilberstein A%2C Schell J%2C Koncz C%2C Szabados L %281997%29 Differential expression of two P5CS genes controlling proline accumulation during salt�?�stress requires ABA and is regulated by ABA1%2C ABI1 and AXR2 in Arabidopsis%2E The Plant Journal 12%3A 557%2D569&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Strizhov&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Strizhov&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Szabados L%2C Savoure A %282010%29 Proline%3A a multifunctional amino acid%2E Trends in Plant Science 15%3A 89%2D97&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Szabados&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Proline: a multifunctional amino acid&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Proline: a multifunctional amino acid&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Szabados&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Székely G%2C Ábrahám E%2C Csépl�? Á%2C Rigó G%2C Zsigmond L%2C Csiszár J%2C Ayaydin F%2C Strizhov N%2C Jásik J%2C Schmelzer E %282008%29 Duplicated P5CS genes of Arabidopsis play distinct roles in stress regulation and developmental control of proline biosynthesis%2E The Plant Journal 53%3A 11%2D28&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sz�?©kely&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Duplicated P5CS genes of Arabidopsis play distinct roles in stress regulation and developmental control of proline biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Duplicated P5CS genes of Arabidopsis play distinct roles in stress regulation and developmental control of proline biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sz�?©kely&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Szoke A%2C Miao G%2DH%2C Hong Z%2C Verma DPS %281992%29 Subcellular location of �? 1%2Dpyrroline%2D5%2Dcarboxylate reductase in root%2Fnodule and leaf of soybean%2E Plant Physiology 99%3A 1642%2D1649&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Szoke&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Subcellular location of �?�? 1-pyrroline-5-carboxylate reductase in root/nodule and leaf of soybean&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Subcellular location of �?�? 1-pyrroline-5-carboxylate reductase in root/nodule and leaf of soybean&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Szoke&as_ylo=1992&as_allsubj=all&hl=en&c2coff=1



Uno Y, Furihata T, Abe H, Yoshida R, Shinozaki K, Yamaguchi-Shinozaki K (2000) Arabidopsis basic leucine zipper transcription factorsinvolved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proceedings of theNational Academy of Sciences 97: 11632-11637


Verbruggen N, Villarroel R, Van Montagu M (1993) Osmoregulation of a pyrroline-5-carboxylate reductase gene in Arabidopsis thaliana.Plant Physiology 103: 771-781


Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis.Nature protocols 2: 1565-1572


Yoshida R, Hobo T, Ichimura K, Mizoguchi T, Takahashi F, Aronso J, Ecker JR, Shinozaki K (2002) ABA-activated SnRK2 protein kinaseis required for dehydration stress signaling in Arabidopsis. Plant and Cell Physiology 43: 1473-1483


Yoshida T, Fujita Y, Maruyama K, Mogami J, Todaka D, Shinozaki K, Yamaguchi‐Shinozaki K (2015) Four Arabidopsis AREB/ABFtranscription factors function predominantly in gene expression downstream of SnRK2 kinases in abscisic acid signalling in responseto osmotic stress. Plant, Cell & Environment 38: 35-49


Yoshida T, Fujita Y, Sayama H, Kidokoro S, Maruyama K, Mizoi J, Shinozaki K, Yamaguchi‐Shinozaki K (2010) AREB1, AREB2, and ABF3are master transcription factors that cooperatively regulate ABRE‐dependent ABA signaling involved in drought stress tolerance andrequire ABA for full activation. The Plant Journal 61: 672-685


Yuan X, Yang Z, Li Y, Liu Q, Han W (2016) Effects of different levels of water stress on leaf photosynthetic characteristics andantioxidant enzyme activities of greenhouse tomato. Photosynthetica 54: 28-39



http://www.ncbi.nlm.nih.gov/pubmed?term=Toniatti C%2C Demartis A%2C Monaci P%2C Nicosia A%2C Ciliberto G %281990%29 Synergistic trans%2Dactivation of the human C%2Dreactive protein promoter by transcription factor HNF%2D1 binding at two distinct sites%2E The EMBO Journal 9%3A 4467&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Toniatti&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Synergistic trans-activation of the human C-reactive protein promoter by transcription factor HNF-1 binding at two distinct sites.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Synergistic trans-activation of the human C-reactive protein promoter by transcription factor HNF-1 binding at two distinct sites.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Toniatti&as_ylo=1990&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Uno Y%2C Furihata T%2C Abe H%2C Yoshida R%2C Shinozaki K%2C Yamaguchi%2DShinozaki K %282000%29 Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid%2Ddependent signal transduction pathway under drought and high%2Dsalinity conditions%2E Proceedings of the National Academy of Sciences 97%3A 11632%2D11637&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Uno&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Uno&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Verbruggen N%2C Villarroel R%2C Van Montagu M %281993%29 Osmoregulation of a pyrroline%2D5%2Dcarboxylate reductase gene in Arabidopsis thaliana%2E Plant Physiology 103%3A 771%2D781&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Verbruggen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Osmoregulation of a pyrroline-5-carboxylate reductase gene in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Osmoregulation of a pyrroline-5-carboxylate reductase gene in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Verbruggen&as_ylo=1993&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yoo SD%2C Cho YH%2C Sheen J %282007%29 Arabidopsis mesophyll protoplasts%3A a versatile cell system for transient gene expression analysis%2E Nature protocols 2%3A 1565%2D1572&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yoo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yoo&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yoshida R%2C Hobo T%2C Ichimura K%2C Mizoguchi T%2C Takahashi F%2C Aronso J%2C Ecker JR%2C Shinozaki K %282002%29 ABA%2Dactivated SnRK2 protein kinase is required for dehydration stress signaling in Arabidopsis%2E Plant and Cell Physiology 43%3A 1473%2D1483&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yoshida&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=ABA-activated SnRK2 protein kinase is required for dehydration stress signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=ABA-activated SnRK2 protein kinase is required for dehydration stress signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yoshida&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yoshida T%2C Fujita Y%2C Maruyama K%2C Mogami J%2C Todaka D%2C Shinozaki K%2C Yamaguchi�?�Shinozaki K %282015%29 Four Arabidopsis AREB%2FABF transcription factors function predominantly in gene expression downstream of SnRK2 kinases in abscisic acid signalling in response to osmotic stress%2E Plant%2C Cell %26 Environment 38%3A 35%2D49&dopt=abstract


http://scholar.google.com/scholar?as_q=Four Arabidopsis AREB/ABF transcription factors function predominantly in gene expression downstream of SnRK2 kinases in abscisic acid signalling in response to osmotic stress&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Four Arabidopsis AREB/ABF transcription factors function predominantly in gene expression downstream of SnRK2 kinases in abscisic acid signalling in response to osmotic stress&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yoshida&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yoshida T%2C Fujita Y%2C Sayama H%2C Kidokoro S%2C Maruyama K%2C Mizoi J%2C Shinozaki K%2C Yamaguchi�?�Shinozaki K %282010%29 AREB1%2C AREB2%2C and ABF3 are master transcription factors that cooperatively regulate ABRE�?�dependent ABA signaling involved in drought stress tolerance and require ABA for full activation%2E The Plant Journal 61%3A 672%2D685&dopt=abstract



http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yoshida&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yuan X%2C Yang Z%2C Li Y%2C Liu Q%2C Han W %282016%29 Effects of different levels of water stress on leaf photosynthetic characteristics and antioxidant enzyme activities of greenhouse tomato%2E Photosynthetica 54%3A 28%2D39&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yuan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Effects of different levels of water stress on leaf photosynthetic characteristics and antioxidant enzyme activities of greenhouse tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Effects of different levels of water stress on leaf photosynthetic characteristics and antioxidant enzyme activities of greenhouse tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yuan&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1


1 research article - plantphysiol.org · 116 cultivar scarlett (ssp. vulgare). here, we report the...

Documents