1 new insights into the lpt machinery for lps transport to the cell

JOURNAL OF BACTERIOLOGY, Mar. 2011, p. 1042–1053 Vol. 193, No. 50021-9193/11/$12.00 doi:10.1128/JB.01037-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.

New Insights into the Lpt Machinery for Lipopolysaccharide Transportto the Cell Surface: LptA-LptC Interaction and LptA Stability as

Sensors of a Properly Assembled Transenvelope Complex�

Paola Sperandeo,1 Riccardo Villa,1 Alessandra M. Martorana,2† Maria Samalikova,1Rita Grandori,1 Gianni Deho,2 and Alessandra Polissi1*

Dipartimento di Biotecnologie e Bioscienze, Universita di Milano-Bicocca, Milan, Italy,1 andDipartimento di Scienze Biomolecolari e Biotecnologie, Universita degli Studi di Milano, Milan, Italy2

Received 31 August 2010/Accepted 10 December 2010

Lipopolysaccharide (LPS) is a major glycolipid present in the outer membrane (OM) of Gram-negativebacteria. The peculiar permeability barrier of the OM is due to the presence of LPS at the outer leaflet of thismembrane that prevents many toxic compounds from entering the cell. In Escherichia coli LPS synthesizedinside the cell is first translocated over the inner membrane (IM) by the essential MsbA flippase; then, sevenessential Lpt proteins located in the IM (LptBCDF), in the periplasm (LptA), and in the OM (LptDE) areresponsible for LPS transport across the periplasmic space and its assembly at the cell surface. The Lptproteins constitute a transenvelope complex spanning IM and OM that appears to operate as a single device.We show here that in vivo LptA and LptC physically interact, forming a stable complex and, based on theanalysis of loss-of-function mutations in LptC, we suggest that the C-terminal region of LptC is implicated inLptA binding. Moreover, we show that defects in Lpt components of either IM or OM result in LptAdegradation; thus, LptA abundance in the cell appears to be a marker of properly bridged IM and OM.Collectively, our data support the recently proposed transenvelope model for LPS transport.

Lipopolysaccharide (LPS) is a complex glycolipid uniquelypresent in the outer layer of Gram-negative bacteria outermembrane (OM) (20, 21). LPS, also known as endotoxin, isone of the major virulence factors of Gram-negative bacteriaand is responsible for the activation of the mammalian innateimmune response (17). It consists of three distinct structuralelements: lipid A (the hydrophobic moiety embedded in theOM), a core oligosaccharide, and the O antigen constituted ofpolysaccharide repeating units (21). LPS is essential in mostGram-negative bacteria, with the notable exception of Neisse-ria meningitidis (32). The lipid A-core moiety is synthesized inthe cytoplasm and is flipped from the inner to the outer leafletof the inner membrane (IM) by the essential ABC transporterMsbA (6, 19, 43). In bacterial strains producing the O antigen,ligation to the core oligosaccharide occurs at the periplasmicface of the IM, after MsbA-mediated translocation (21). Ma-ture LPS, containing or not the O antigen, is then transportedto the outer leaflet of the OM by a protein machine composedof seven recently discovered Lpt proteins (reviewed by Spe-randeo et al. [28]) suggested to build up a complex (the Lptcomplex) that spans the IM and OM. Indeed, these proteinsare located at the IM (LptBCFG), in the periplasm (LptA),and at the OM (LptDE) (3, 23, 27, 29, 30, 33, 41). Geneticevidence suggests that the Lpt complex operates as a singledevice, since the depletion of any component leads to similar

phenotypes, namely, failure to transport newly synthesizedLPS to the cell surface and its accumulation at the outer leafletof the IM (16, 23, 29). The LPS accumulating at the outerleaflet of the IM is decorated with colanic acid residues, andtherefore this modification is diagnostic of defects in transportoccurring downstream of the MsbA-mediated flipping of LPSto the periplasmic face of the IM (29).

Physical interaction between the different proteins of themachinery has been demonstrated for LptDE, which form acomplex at the OM (41), and for the IM LptBCFG complex(18). LptD and LptE are responsible for the LPS assembly atthe cell surface; LptE stabilizes LptD by interacting with itsC-terminal domain, whereas LptE binds LPS, possibly servingas a substrate recognition site at the OM (5). LptC is an IMbitopic protein whose large soluble domain has a periplasmiclocalization (38). The crystal structure of LptC periplasmicdomain has been recently solved and, like LptA, LptC has beenshown to bind LPS in vitro (38). LptC physically interacts withthe IM LptBFG proteins, and the LptBCFG complex is the IMABC transporter that energizes the LPS transport (18). How-ever, LptC seems not to be required for the ATPase activity ofthe transporter (18).

LptA expressed from an inducible promoter has a periplas-mic localization and has been shown to bind both LPS and lipidA in vitro (27, 39). These data raise the possibility that LptAmay act as a periplasmic chaperone for LPS transport acrossthe periplasm. However, in N. meningitidis the LptA homo-logue was shown to be associated to the membrane fraction(2). Moreover, in the Escherichia coli LptA crystal structureobtained in the presence of LPS, the LptA monomers arepacked as a linear filament (34), leading to the hypothesis thatoligomers of LptA may be required to bridge the IM and the

* Corresponding author. Mailing address: Dipartimento di Biotecnolo-gie e Bioscienze, Universita di Milano-Bicocca, Piazza della Scienza 2,20126 Milan, Italy. Phone: 39-02-64483431. Fax: 39-02-64483450. E-mail:[email protected].

† Present address: Dipartimento di Biotecnologie e Bioscienze, Uni-versita di Milano-Bicocca, Milan, Italy.

� Published ahead of print on 17 December 2010.

1042

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

OM, thus facilitating LPS export. The observation that LPS isstill transported to the OM in spheroplasts devoid of periplas-mic content (35) is consistent with this idea. In line with thesedata it has been recently reported that all seven Lpt proteinsphysically interact and form a transenvelope complex spanningIM and OM (4).

In the present study we show that in vivo LptA and LptCphysically interact and form a stable complex, suggesting thatLptC may represent a docking site for LptA to the IM. Basedon analyses of loss-of-function mutations in LptC, we predictthat the C-terminal region of LptC is implicated in LptA bind-ing and that LptC may form dimers. Finally, after analyzing therelative stability of the Lpt proteins when LptC, LptD, or LptEare either depleted or not functional, we suggest that LptA

connects IM and OM via LptC and the LptDE complex andthat LptA abundance in the cell may be used as a marker ofproperly bridged IM and OM.

MATERIALS AND METHODS

Bacterial strains and media. The bacterial strains and plasmids examined hereare listed in Table 1. The oligonucleotide primers are listed in Table 2.

Bacteria were grown in LD medium (24). When required, 0.2% (wt/vol)L-arabinose (as an inducer of the araBp promoter), 0.1 or 0.5 mM IPTG (iso-propyl-�-D-thiogalactopyranoside), 100 �g of ampicillin/ml, 25 �g of chloram-phenicol/ml, and 25 �g of kanamycin/ml were added. Solid media were preparedas described above with 1% agar.

Plasmid construction. Plasmid pGS108 expresses LptC with a C-terminal His6

tag (LptC-H) from the IPTG-inducible Ptac promoter (Table 1). PlasmidspGS108G56V, pGS103G153R, and pGS108G153R expressing LptCG56V-H,

TABLE 1. Bacterial strains and plasmids

Strain or plasmid Relevant characteristicsa Source or reference

StrainsAM604 MC4100 ara� 41AM661 AM604 �lptD::kan/araBp-lptD 29AM689 AM604 �lptE::kan �(�att-lom)::bla araBp-lptE 41DH5� �(argF-lac169) 80dlacZ58(M15) glnV44(AS) �� rfbD1 gyrA96 recA1 endA1 spoT1 thi-1 hsdR17 11FL905 AM604 �(kan araC araBp-lptC)1 29FL907 AM604 �(kan araC araBp-lptA)1 29M15/pREP4 F� lac thi mtl/pREP4 Qiagen

PlasmidspRSET T7 promoter; Apr InvitrogenpET30b T7 promoter; Kmr NovagenpET30-lptC-lk25-H pET30b derivative, expresses a LptC-lk25-His6 version where lk is a 25-amino-acid linker

region separating LptC residue 191 from the His6 affinity tagThis study

pQE30 T5 promoter; Apr QiagenpQEsH-lptC pQE30 derivative, expresses His6-LptC24-191 This studypGS100 pGZ119EH derivative, contains TIR sequence downstream of Ptac; Cmr 30pGS103 pGS100 Ptac-lptC 30pGS103�177-191 pGS103 Ptac-lptC�177-191 This studypGS103G56V pGS103 Ptac-lptC(G56V) This studypGS103Y112S-G153R pGS103 Ptac-lptC(Y112S-G153R) This studypGS103G153R pGS103 Ptac-lptC(G153R) This studypGS108 pGS100 Ptac-lptC-H 30pGS108�177-191 pGS108 Ptac-lptC�177-191-H This studypGS108G153R pGS108 Ptac-lptC(G153R)-H This studypGS108G56V pGS108 Ptac-lptC(G56V)-H This studypGS116 pGS103�177-191 derivative expressing both the truncated LptC�177-191 and LptC-lk25 from

pET30- lptC-lk25-H plasmidThis study

a Cmr, chloramphenicol resistance; Apr, ampicillin resistance; Kmr, kanamycin resistance.

TABLE 2. Oligonucleotides

Name Sequence (5–3)a Use and/or description

AP24 cgactagtctagaTTAAGGCTGAGTTTGTTTG Random mutagenesis with AP54; XbaIAP54 cgagaggaattcaccATGAGTAAAGCCAGACGTTGGG pGS108�177-191 construction, with AP172 and random

mutagenesis with AP24; EcoRIAP149 atatacatATGAGTAAAGCCAGACGTTG pET30-lptC-H construction, with AP150; NdeIAP150 cgcgcaggtaccAGGCTGAGTTTGTTTGTTTTG pET30-lptC-H construction, with AP149; KpnIAP164 GTCTATAACCCAGAAGTGGCACTAAGCTATCG pGS108G56V construction, with AP165AP165 CGATAGCTTAGTGCCACTTCTGGGTTATAGAC pGS108G56V construction, with AP164AP166 cgagatggatccATGGCCGAAAAAGACGATAC pQEsH-lptC construction, with AP167; BamHIAP167 cgagatctgcagTTAAGGCTGAGTTTGTTTG pQEsH-lptC construction, with AP166; PstIAP168 CTCGTCACGTTATACAGAACAACATTTAACTC pGS108G153R and pGS103G153R construction, with AP169AP169 GAGTTAAATGTTGTTCTGTATAACGTGACGAG pGS108G153R and pGS103G153R construction, with AP168AP172 gtgatcacatctagatcagtggtggtggtggtggtgTTCAATCAGCTCGGCGTTC pGS108�177-191 construction, with AP54; insertion of C-

terminal His6 tag into LptC�177-191; XbaI

a Uppercase letters, E. coli genomic sequence; underlined lowercase letters, restriction sites; boldface letters, codons mutated by site-directed mutagenesis.

VOL. 193, 2011 LptA-LptC INTERACTION IN Lpt TRANSPORT MACHINERY 1043

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

LptCG153R, and LptCG153R-H, respectively, were constructed by using aQuikChange site-directed mutagenesis kit (Stratagene). Codon 56 was changedfrom GGG to GTG by using the primer pair AP164-AP165, and codon 153 waschanged from GGA to AGA by using the primer pair AP168-AP169 (Table 2).Plasmid pGS108�177-191 expressing LptC�177-191-H, truncated at residue 177,was constructed by PCR amplifying the lptC open reading frames from genomicMG1655 DNA with the primer pair AP54-AP172 (Table 2). The PCR productwas EcoRI-XbaI digested and cloned into pGS108 cut with the same enzymes.The EcoRI-XbaI insert in pGS108�177-191, as well as the mutations inpGS108G56V, pGS108G153R, and pGS103G153R, was verified by sequencing.

Plasmid pQEsH-lptC expresses a soluble cytoplasmic version of LptC deprivedof the transmembrane helix and with an N-terminal His6 affinity tag (sH-LptC)(Table 1). A 507-bp DNA fragment, encoding residues 24 to 191 of LptC, wasamplified from MG1655 DNA with the primers AP166 and AP167 (Table 2) andcloned into the BamHI and PstI sites of pQE30 (Qiagen). The His6 affinity tagis separated from the first residue of LptC24-191 by two amino acids (G-S). TheBamHI-PstI insert was verified by sequencing.

Plasmid pET30-lptC-lk25-H expresses a C-terminally His6-tagged version ofLptC (LptC-lk25-H) with a 25-amino-acid linker region (GTDDDDKAMAISDPNSSSVDKLAAALE) containing the enterokinase recognition site (DDDDK)(Table 1). The lptC open reading frame was amplified from MG1655 DNA withthe primers AP149 and AP150 (Table 2). The PCR product was NdeI-KpnIdigested and cloned into the NdeI-KpnI sites of pET30b (Novagen). The NdeI-KpnI insert was verified by sequencing.

Plasmid pGS116 is a pGS103�177-191 derivative expressing LptC-lk25, togetherwith LptC�177-191 from the IPTG-inducible Ptac promoter (Table 1). The XbaI-HindIII fragment of pET30-lptC-lk25-H, containing the ribosome binding site(RBS) region, the lptC gene without its stop codon and part of the plasmidmultiple cloning site was inserted into the XbaI-HindIII sites of pGS103�177-191.The resulting plasmid expresses LptC (LptC-lk25) in frame with a 27-amino-acidcoding sequence (GTDDDDKAMAISDPNSSSVDKLGCFGG). In this con-struct the His6 affinity tag is lost.

Random mutagenesis, screening, and genetic characterization of LptC mu-tants. Random mutagenesis was performed by error-prone PCR using an un-balanced deoxynucleoside triphosphates concentration in the amplification re-actions, as described previously (9). pGS103 expressing lptC from the Ptacpromoter was used as a template (10 ng) in 50 �l with 50 pmol each of primersAP54 and AP24 (Table 2). The PCR conditions were as follows: 95°C denatur-ation for 2 min; 30 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min;followed by a 5-min extension at 72°C. The products were gel purified, digestedwith XbaI and EcoRI, ligated into pGS100, and electroporated into FL905 cells.The transformants were plated onto LD agar with 0.2% arabinose and 25 �g ofchloramphenicol/ml at 37°C. Single colonies were then inoculated into microtiterwells containing 100 �l of LD, serially diluted 10-fold, replica plated on LD-chloramphenicol agar plates supplemented with (permissive condition) or with-out (nonpermissive condition) 0.2% arabinose, and incubated overnight at 37°C.Plasmids unable to support FL905 growth in the absence of arabinose wereidentified and sequenced.

To test the effect of LptC mutant overexpression, serial dilutions of culturesgrown overnight in LD-chloramphenicol were replica plated on LD-chloram-phenicol agar plates supplemented or not with 0.5 mM IPTG.

In vivo cross-linking. The cross-linking experiments were based on previouslydescribed methods (36) with some modifications. The cells were grown in 250 mlof LD medium supplemented with either chloramphenicol or ampicillin to anoptical density at 600 nm (OD600) of 0.2, induced with 0.1 mM IPTG, and grownto an OD600 of 0.7. The cells were then harvested by centrifugation at 5,000 �g for 10 min. For treatment with DSP (di-thiobis[succinimidyl propionate];Pierce), the cell pellet was washed with 25 ml of 20 mM potassium phosphate(pH 7.2) and 150 mM NaCl, resuspended in 25 ml of the same buffer, and thenincubated for 15 min at 37°C. DSP dissolved in dimethyl sulfoxide was added tothe cell suspension at a final concentration of 80 �g/ml, and the cells wereincubated for 30 min at 37°C. The cross-linking reaction was quenched by theaddition 1 M Tris-HCl (pH 7.4) to a final concentration of 20 mM, and the cellswere harvested by centrifugation at 5,000 � g for 10 min.

For whole-cell extract analysis, the cells were grown in 50 ml of LD-chloram-phenicol to an OD600 of 0.2, induced with 0.1 mM IPTG, and grown to an OD600

of 0.7. DSP treatment was performed as described above using two-thirds ofeach culture, whereas the reminder one-third was not treated. After the additionof 20 mM Tris-HCl (pH 7.4), the cells were centrifuged and washed twice in 20mM potassium phosphate (pH 7.2) and 150 mM NaCl. The cell pellet wasresuspended in 100 �l of sodium dodecyl sulfate (SDS) sample buffer containingor not containing 5% �-mercaptoethanol and boiled for 5 min.

Affinity purification. Protein purification was performed as described previously(26). The cell pellets were resuspended in 4 ml of 50 mM potassium phosphate buffer(pH 8.0), 150 mM NaCl, 5 mM MgCl2, and 1% ZW3-14 (n-tetradecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) containing lysozyme (50 �g/ml), DNase I (50 �g/ml), and RNase I (50 �g/ml) and then lysed by shaking for 20 min at room temper-ature. To remove cell debris after lysis, the mixture was then centrifuged at 10,000 �g for 10 min. To the cleared lysate (whole-cell extract) 20 mM imidazole (pH 8.0)was added, and the final mixture was loaded onto a 0.4-ml Ni-NTA column. Thecolumn was first washed with 8 ml of 50 mM potassium phosphate buffer (pH 8.0),300 mM NaCl, 20 mM imidazole, 0.1% Triton X-100, and 0.1% SDS and then elutedwith 4 ml of 50 mM potassium phosphate buffer (pH 8.0), 300 mM NaCl, and 200mM imidazole. The eluate was concentrated in an ultrafiltration device (AmiconUltra [Millipore]; molecular weight cutoff, 10,000) by centrifugation at 5,000 � g.The concentrated sample was used for SDS-PAGE and Western blot analysis asdescribed above.

Purification of sH-LptC. M15/pREP4 carrying the plasmid pQEsH-lptC wasgrown at 30°C in LD containing kanamycin (25 �g/ml) and ampicillin (100�g/ml) for 18 h. This culture was diluted 1:100 in fresh medium and grown untilmid-logarithmic phase (OD600, 0.6). The expression of sH-LptC was inducedovernight at 20°C by adding IPTG to a final concentration of 0.5 mM. Cells werethen harvested by centrifugation (5,000 � g, 10 min). The cell pellet was resus-pended in buffer A (50 mM NaH2PO4 [pH 8.0] containing 300 mM NaCl, 10 mMimidazole, and 10% glycerol), followed by incubation for 30 min at 4°C withshaking in the presence of lysozyme (0.2 mg/ml), DNase (100 �g/ml), 10 mMMgCl2, and 1 mM phenylmethylsulfonyl fluoride. After 10 cycles of sonication(10-s pulses), the unbroken cells were removed by centrifugation (39,000 � g, 30min). The soluble sH-LptC protein was purified from the supernatant by usingNi-NTA agarose (Qiagen). The column was washed with 10 column volumes of4% buffer B (50 mM NaH2PO4 [pH 8.0] containing 300 mM NaCl, 500 mMimidazole, and 10% glycerol) in buffer A. The protein was eluted by using astepwise gradient obtained by mixing buffer B with buffer A in 5 steps (10, 20, 50,70, and 100% buffer B). At each step, 1 column volume was flowed through thecolumn. Elution fractions were monitored by 12.5% polyacrylamide SDS-PAGE.The pooled fractions containing purified protein were dialyzed against 100 vol-umes of buffer C (50 mM NaH2PO4 [pH 8.0], 100 mM NaCl) for gel filtrationanalysis, and 100 volumes of 10 mM ammonium acetate pH 7.5 for mass spec-trometry. Protein concentrations were determined by using a Coomassie (Brad-ford) assay kit (Pierce) with bovine serum albumin as the standard.

Mass spectrometry. Electrospray ionization-mass spectrometry (ESI-MS) ex-periments were performed on a hybrid quadrupole-time-of-flight mass spectrom-eter (QSTAR Elite; Applied Biosystems, Foster City, CA) equipped with anano-ESI sample source. Metal-coated borosilicate capillaries (Proxeon,Odense, Denmark), with medium-length emitter tips (1-�m internal diameter),were used to infuse the samples. The instrument was calibrated using the renininhibitor (1,757.9 Da) (Applied Biosystems) and its fragment (109.07 Da) asstandards. Spectra were acquired in the 500 to 5,000 m/z range, with accumula-tion times of 1 s, an ion-spray voltage of 1,300 V, a declustering potential of 40V, and an instrument interface at room temperature. Spectra were averaged overa period of at least 3 min.

Analytical gel filtration chromatography. Size-exclusion chromatography wasperformed on an AKTA purifier liquid-chromatography system (GE Healthcare,Amersham Place, Little Chalfont, United Kingdom), using a prepacked, Super-dex 75HR column (30 by 1 cm; GE Healthcare, Amersham Place, Little Chal-font, United Kingdom). Chromatography was carried out at room temperaturein 50 mM NaH2PO4 (pH 8.0)–100 mM NaCl at a flow rate of 0.5 ml/min andmonitored by the eluate absorbance at 280 nm. The calibration curve was con-structed by using the following standards (0.5 mg/ml): transferrin (81,000 Da),chicken ovalbumin (43,000 Da), chymotrypsin (21,500 Da), bovine cytochrome c(12,200 Da), and aprotinin (6,500 Da) (Sigma Aldrich, St. Louis, MO). LptC wasinjected at a concentration of 1 mg/ml.

Determination of LptA, LptC, and LptE levels. LptA, LptC, and LptE levelswere assessed in FL905 and its derivatives expressing mutant LptC or in AM661or AM689 strains by Western blot analysis with polyclonal antibody raised inmouse or rabbit against peptides (LptA) or whole proteins (LptE, LptC, andAcrB). Bacterial cultures grown at 37°C in LD supplemented with 0.2% arabi-nose and 25 �g of chloramphenicol/ml when required were harvested by cen-trifugation after they had reached an OD600 of 0.2, washed in LD, and diluted toOD600s of 0.01 (AM689), 0.004 (AM661), 0.0004 (AM604, FL905/pGS103�177-191,FL905/pGS103, FL905, FL905/pGS103G56V, and FL905/pGS108G153R) infresh media with or without 0.2% arabinose and with 25 �g of chloramphenicol/ml. Growth was monitored by measuring the OD600. Samples for protein analysiswere centrifuged (16,000 � g, 5 min), and pellets were resuspended in a volume(in ml) of SDS sample buffer equal to one-eighth of the total OD of the sample.

1044 SPERANDEO ET AL. J. BACTERIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

The samples were boiled for 5 min, and equal volumes (25 �l) were analyzed bySDS–12.5% PAGE. Proteins were transferred onto nitrocellulose membranes(GE Healthcare), and Western blot analysis was performed as previously de-scribed (27). Polyclonal sera raised against LptA (GenScript Corp.) were used asprimary antibody at a dilution of 1:2,000, whereas polyclonal sera against LptC,LptE (kindly provided by D. Kahne), and AcrB (kindly provided by K. M. Pos)were used at a dilution of 1:5,000. As secondary antibodies, sheep anti-mouseimmunoglobulin G–horseradish peroxidase (HRP) conjugate (GE Healthcare)and donkey anti-rabbit immunoglobulin G–HRP conjugate (GE Healthcare)were used at dilutions of 1:5,000.

Analyses of LptC-H mutant stability. The expression of LptC was induced with0.1 mM IPTG at an OD600 of 0.3 to 0.4 in cultures grown in LD-chloramphen-icol, and 1-ml samples were taken immediately before and 15, 30, and 60 minafter induction. Samples preparation and Western blotting were performed asdescribed above, and wild-type and mutant versions of LptC-H were visualizedby using HisProbe-HRP (Pierce) according to the manufacturer’s instructions.

Total LPS extraction and analysis. LPS extraction from AM604 and FL905transformed or not with plasmids carrying wild-type or mutant LptC was per-formed as previously described. Samples of a total OD600 of 2 were taken, andLPS was extracted from cell pellets by a mini phenol-water extraction technique(22). Briefly, the cells were resuspended in water and pelleted (5 min, 10,000 �g) to remove the exopolysaccharides and then resuspended in 0.3 ml of potassiumphosphate buffer (pH 7.0) and thoroughly vortexed; 0.3 ml of phenol equilibratedwith 0.1 M Tris-HCl (pH 5.5) was added, and the suspension was vortexed. Thetubes were placed in a 65°C heating block for 15 min with thorough vortexingevery 5 min and then cooled on ice. After centrifugation (10,000 � g, 5 min), thewater phase was removed, dialyzed (molecular mass cutoff, 2,000 to 4,000 Da)against phosphate buffer (pH 7.0), and lyophilized. The lyophilized material wasthen dissolved in 30 �l of water. LPS was separated by N-[2-hydroxy-1,1-bis(hy-droxymethyl)ethyl]glycine–SDS-PAGE (31) and visualized by silver staining ac-cording to the Hitchcock and Brown method as described previously (27).

RESULTS

LptC stably associates with LptA. Previous work by our andother laboratories (27, 39) suggested that LptA expressed froman inducible promoter has a periplasmic localization. However,evidence of direct physical interaction between the seven Lptproteins has been recently reported and LptA has been shownto associate with both IM and OM (4). Since the bitopic IMLptC protein possesses a large C-terminal periplasmic domain(E26-P191) (38), we hypothesized that LptA binding to the IMcould be mediated by LptC. To address this issue, we probedthe interaction between LptA and LptC by affinity purificationfollowed by immunoblotting. A C-terminal His tagged versionof LptC (LptC-H) overexpressed from plasmid pGS108 in thewild-type strain AM604 was used as bait in copurification ex-periments. AM604 harboring the pRSET vector, which allowsthe basal expression of the His tag alone, was used as a nega-tive control. To detect possible weak or transient interactions,in vivo cross-linking using di-thiobis(succinimidyl propionate)(DSP) (42) was also performed. As shown in Fig. 1, LptAcopurified with LptC-H even when DSP was not added to thecells overexpressing LptC-H, suggesting a stable LptA-LptCinteraction. When samples treated with DSP were not revertedby a reducing agent, high-molecular-weight bands appeared(Fig. 1, upper and lower panel, bands C1 and C2). C1 maycorrespond to an LptA-LptC complex, whereas the C2 bandthat appears only in the lower panel might correspond to anLptC-LptC complex, as inferred by the molecular weight.These data suggest that LptA and LptC interact and form astable complex.

Isolation of inactive lptC mutant alleles. To better charac-terize LptA-LptC interaction and to define the molecular roleof LptC in LPS transport, we searched for point mutations that

inactivate LptC function. Random mutations were introducedby error-prone PCR into lptC carried by pGS103 (Table 1), andthe mutagenized plasmids were tested for complementation ofLptC�-depleted cells, as described in Materials and Methods.Briefly, LptC� depletion strain FL905 was transformed withthe mutagenized plasmids in the presence of arabinose, andplasmids unable to support FL905 growth in the absence ofarabinose were isolated. Of 1,664 transformants analyzed, weobtained 21 clones unable to fully complement FL905 in thenonpermissive conditions. Most noncomplementing clonesharbored multiple mutations, as assessed by sequencing themutant alleles. Nevertheless, three plasmids harbored only oneor two mutations in LptC (Fig. 2A), namely, G56V, K177Stop(which generates a truncated protein lacking the C-terminal 15amino acids [�177-191]), and Y112S-G153R (a double substitu-tion mutant in the C-terminal region). FL905/pGS103�177-191

and FL905/pGS103Y112S-G153R growth was completely in-hibited on agar medium in the absence of arabinose, whereasFL905/pGS103G56V growth was severely impaired in the ab-sence of arabinose and formed “dust-like colonies” in thiscondition (Fig. 2B).

FIG. 1. LptA interacts with LptC in vitro. Affinity chromatographyexperiments were performed in the presence or absence of DSP inAM604/pGS108 overexpressing LptC-H (wt/LptC-H) and AM604/pRSET (wt/none) expressing the His tag element only, as a negativecontrol. LptA and LptC were detected in Ni-NTA column-enrichedfractions by Western blot analysis with anti-LptA antibody and His-Probe-HRP, respectively. LptA detected in crude cell extract (CE) ofAM604 (wt) and of FL907 mutant overexpressing LptA (araBp-lptA)was used as a marker. Samples were treated with dithiothreitol (DTT)and/or �-mercaptoethanol (�-ME) to revert the cross-linking. Equalamounts of protein (2 �g) were loaded into each lane. C1 and C2,high-molecular-weight complexes. The SlyD protein of 24 kDa cross-reacting with anti-LptA antibodies is labeled (�).


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

The G153R substitution was also found in other multiple mu-tants isolated in our screening associated with different aminoacid substitutions, suggesting that G153R could be the residueresponsible of the observed phenotype. This was confirmed by thefact that both pGS103G153R and pGS108G153R, which ex-presses a His6-tagged LptCG153R mutant protein generated by

site-directed mutagenesis (LptCG153R-H) (Table 1), were un-able to complement FL905 (Fig. 2B). In all of the experimentsdescribed below, FL905/pGS108G153R was used. The mutationsdescribed above fall in conserved regions of the protein (see, forexample, the sequence alignments of LptC orthologues from pro-teobacteria in reference 38).

Stability of the LptC mutant proteins. To assay the stabilityof LptC mutant proteins, we examined the level of ectopicallyexpressed LptC-H (which can be distinguished from the en-dogenous wild-type protein) and its mutant derivatives in thewild-type strain AM604 upon induction with IPTG, assumingthat the level of de novo-synthesized proteins correlates withtheir stability. It should be noted that in these conditions thechromosomal wild-type copy of lptC is expressed from its nat-ural promoter. Detection of the proteins using HisProbe-HRPrevealed that the level of LptCG56V-H was comparable to thatof LptC-H and only the basal level (before IPTG induction) ofLptCG153R-H was affected, suggesting that this protein is onlyslightly unstable (Fig. 3A). On the contrary, the level of thetruncated LptC�177-191-H protein was severely reduced underthese conditions, indicating that the truncated protein is intrin-sically unstable.

We then tested the effect of LptC mutants overexpression onE. coli growth by plating wild-type strain AM604 harboringpGS108, pGS108G56V, pGS108�177-191, and pGS108G153Ron agar medium in the absence or in the presence of IPTG.Overexpression of LptCG56V did not impair growth; on thecontrary, we found that overexpression of �177-191 and G153RLptC-H mutants abolished AM604 growth (Fig. 3B). SinceLptC is part of a multiprotein complex these data suggest thateither the mutants may titrate a wild-type interacting Lpt fac-tor(s) or that their toxicity may be due to the overexpression ofa misfolded protein.

The C-terminal region of LptC is required for LptA binding.To test whether the G56V, �177-191, and G153R mutationscould affect LptC interaction with LptA, we compared thewild-type and the mutant proteins for their ability to copurify

FIG. 2. Mutations affecting LptC function. (A) Mutations in thelptC gene in the pGS103-derived plasmids. Nucleotide coordinatenumbers are based on the designation of the start codon of lptC as 1.The amino acid numbers are based on the predicted sequence of LptCthat is 191 amino acids in length. (B) Plating efficiency of FL905(araBp-lptC) transformed with plasmid pGS103 carrying the wild-typeprotein (LptC and LptC-H, respectively), or plasmids carrying theLptC mutated proteins LptCG56V, LptC�177-191, LptCG153R,LptCG153R-H, or plasmid pGS100 (none), in agar plate containingchloramphenicol supplemented (�) or not (�) with arabinose. Serialdilutions are given on the left side of the panel.

FIG. 3. LptC mutant stability in vivo and effects of their overexpression. (A) LptC mutant stability. AM604 cells harboring pGS108 (LptC-H),pGS108G56V (LptCG56V-H), pGS108G153R (LptCG153R-H), and pGS108�177-191 (LptC�177-191-H) were grown to the early logarithmic phase.Expression of LptC-H or its mutant forms were induced by the addition of 0.1 mM IPTG. Samples for protein analysis were obtained 0, 15, 30,and 60 min postinduction and analyzed using HisProbe-HRP. Equal amount of cells (0.12 OD600 units) was loaded into each lane. (B) Overex-pression of LptC�177-191 and LptCG153R leads to cell lethality. Serial dilutions (indicated on the left) of overnight cultures of AM604 carrying theplasmids pGS108, pGS108G56V, pGS108�177-191, and pGS108G153R were replica plated onto agar plate supplemented (�) or not (�) with 0.5mM IPTG and incubated overnight.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

LptA. Whole-cell extracts of the wild-type strain AM604 over-expressing LptC-H or the mutant His-tagged derivatives(G56V, �177-191, and G153R; Table 1) were subjected to affin-ity purification and LptA and LptC-H detected by Westernblotting with anti-LptA antibodies and HisProbe-HRP, respec-tively. As shown in Fig. 4, LptCG56V-H retained the ability tocopurify LptA, whereas the mutations in the LptC C-terminalregion (G153R and �177-191) severely impaired LptA-LptCcomplex formation.

Effects of different lptC alleles on Lpt complex and LPStransport. To gain better insights into the molecular role ofLptC in the Lpt complex, we tested the effects of the threelptC mutant alleles on the steady-state level of LptA andLptE, the latter as a representative of the LptDE OM com-plex, and on LPS transport. The LptC� depletion strainFL905 and its derivatives harboring pGS103, pGS103G56V,pGS103�177-191, and pGS108G153R were grown to the ex-ponential phase and shifted into a medium lacking arabi-nose (nonpermissive condition) to deplete the chromosom-ally encoded LptC wild type, while allowing expression ofthe mutant proteins. Samples were then taken from cul-tures grown in the presence or absence of arabinose for 240min (AM604, FL905, and FL905/pGS103) or 270 min(FL905/pGS103G56V, FL905/pGS103�177-191, and FL905/pGS108G153R) after the shift to nonpermissive conditions(Fig. 5A) and analyzed by Western blotting with anti-LptA,anti-LptC, and anti-LptE antibodies. The level of the IMprotein AcrB was used as a sample loading control.

As shown in Fig. 5B (upper part), the level of physiologicallyexpressed LptC seemed very low since the protein was unde-tectable in the wild-type strain with our antibody preparation.However, LptC was detected when ectopically expressed froma plasmid or from the araBp promoter (Fig. 5B). In FL905 cellsexpressing LptCG56V and LptCG153R, the level of the mu-tant proteins was comparable under permissive and nonper-missive conditions, whereas LptC�177-191 was undetectable inthe noncomplemented strain (see below).

In the LptC� depletion strain FL905 grown in the presenceof arabinose, lptA is expressed from the upstream araBp pro-moter, and the level of LptA is higher than in the wild-typeAM604 strain, where the protein is expressed from its naturalpromoter (29). The level of LptA in LptC�-depleted cells

expressing LptCG153R-H was similar to that observed in thepositive control (FL905 complemented by wild-type LptC),whereas LptA appeared slightly more abundant in LptC�-depleted cells expressing LptCG56V. On the contrary, in non-complemented LptC�-depleted cells and in cells ectopicallyexpressing LptC�177-191 LptA was undetectable. It thus ap-pears that the absence of LptC protein caused by either de-pletion (noncomplemented LptC�-depleted cells) or mutation(LptC�-depleted cells expressing LptC�177-191) induces LptAdestabilization. The abundance of LptE did not substantiallychange upon depletion of LptC with or without overexpressionof any mutant LptC, indicating that the steady-state level of theOM component LptE was not affected by LptC depletion ormutations (Fig. 5B, upper part). The steady-state level of LptEthus served in these experiments also as a sample loadingcontrol.

Depletion of any Lpt protein leads to the production of LPSdecorated by colanic acid; this phenotype is diagnostic of de-fects in LPS transport occurring downstream of the MsbA-mediated flipping of lipid A-core to the periplasmic face of theIM (29). We therefore analyzed the LPS profile in lptC mutantstrains. The total LPS was extracted from nondepleted andLptC�-depleted FL905 complemented with wild-type and mu-tant lptC alleles, and the LPS profiles were analyzed as de-scribed previously (29). As shown in Fig. 5B (lower part), LPSdecorated with colanic acid could be detected in LptC�-de-pleted FL905 complemented by each of the mutant alleles butnot by wild-type lptC, indicating that each of the above LptCmutations impair LPS transport.

Evidence for LptC oligomerization in vivo. As noted above,LptC�177-191 mutant protein was not detectable upon deple-tion of the chromosomally encoded LptC�, whereas, whenLptC� was coexpressed from the araBp promoter, theLptC�177-191 level was higher (notice that the wild-type andtruncated proteins can be distinguished by their different mo-lecular weights; Fig. 5B, upper part). On the contrary, theLptCG56V and LptCG153R mutant proteins remained abun-dant upon depletion of wild-type LptC. LptC�177-191 is anintrinsically unstable protein (Fig. 3A) and appears to be sta-bilized by overexpression of LptC�, which is consistent withthe idea that LptC might interact with itself to form a dimer(see also Fig. 1) or a multimer. An alternative explanation isthat upon depletion envelope stress response is triggered andperiplasmic proteases are induced that might degrade the un-stable LptC truncated protein. To probe LptC oligomerizationin vivo, we performed in vivo cross-linking experiments usingthe wild-type strain AM604 transformed with different LptCconstructs. In DSP-treated AM604 cells expressing wild-typeLptC a band of 46 kDa was visible consistent with the for-mation of an LptC-LptC complex (Fig. 6, upper panel). The46-kDa band disappeared when the DSP cross-linker was re-verted with a reducing agent. When samples were analyzed byWestern blotting with anti-LptA antibodies, a band of 43kDa was visible that possibly corresponded to an LptA-LptCcomplex (Fig. 6, lower panel). In DSP-treated AM604 cellsexpressing both LptC�177-191 and an LptC version carrying anadditional 27 amino acids at the C-terminal end (LptC-lk25),two high-molecular-mass bands with an apparent masses ofapproximately 46 and 52 kDa appeared, possibly correspond-ing to LptC-lk25–LptC�177-191 and LptC-lk25–LptC-lk25 com-

FIG. 4. Effect of lptC mutations on LptC-LptA interaction. Whole-cell extracts from AM604 cells transformed with plasmids pGS108carrying the wild-type protein (LptC-H) or the LptC-mutated proteinsLptCG56V-H, LptCG153R-H, and LptC�177-191-H were subjected toaffinity chromatography. Equal amounts (2.5 �g) of Ni-NTA column-enriched LptC-H and its mutant versions were separated by SDS–12.5% PAGE and analyzed by Western blotting with anti-LptA anti-body and HisProbe-HRP, respectively.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

FIG. 5. Effect of lptC mutations on Lpt proteins complex and LPS transport. (A) Growth curves of AM604 (wt; a), FL905 (araBp-lptC; b) strainsand FL905 carrying plasmids expressing LptC (c), LptCG56V (d), LptCG153R-H (e), and LptC�177-191 (f). Cells growing exponentially in LDcontaining arabinose were harvested, washed, and subcultured in arabinose-supplemented (}) or arabinose-free (�) medium. Growth was


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

plexes. In DSP-treated cells expressing LptC�177-191 the levelof the truncated protein was low compared to the LptC wildtype and LptC-lk25, a finding consistent with the notion thatthe truncated protein is intrinsically unstable. However, anhigh-molecular-mass band of 44 kDa appeared, suggestingthat even the truncated protein is able to dimerize (Fig. 6,upper panel). These data suggest that LptC can form dimers invivo. However, this experiment does not prove that dimeriza-tion with wild-type LptC protects the truncated LptC�177-191

protein version from degradation in the LptC� depletionstrain FL905. Therefore, we examined the LptC levels in thelptE depletion strain AM689 grown under permissive and non-permissive conditions and expressing either the wild-type orthe truncated LptC�177-191 proteins. As shown in Fig. 7,LptC�177-191 was undetectable when the lptE depletion strainwas grown in the absence of arabinose, an observation in linewith the idea that LptC�177-191 is degraded by proteases in-duced under stress conditions.

Purified LptC is a dimer in solution. In order to probe theoligomeric state of LptC in vitro, the apparent molecularweight of the pure protein was tested by size-exclusion chro-matography and ESI-MS under nondenaturing conditions. Todo this, a preparation of the soluble version of LptC with anN-terminal His6 tag and lacking the first 23 amino acids of the

transmembrane domain was analyzed (sH-LptC [see Materialsand Methods]) by size-exclusion chromatography. The proteineluted as a single, slightly asymmetric peak on a Superdex75column (Fig. 8A, inset). The LptC elution volume corre-sponded to an estimated molecular mass of 43,000 Da, rel-ative to globular calibrants in the range 6,500 to 81,000 Da(Fig. 8A), suggesting a dimeric assembly. This conclusion wasconfirmed by nano-ESI-MS, which provides complementaryinformation by direct detection and weighing of protein non-covalent complexes (13, 14). In Fig. 8B, C, and D, the spectraof pure sH-LptC preparations in the presence of ammoniumacetate, which is known to favor detection of protein com-plexes by mass spectrometry, are reported. At 5 �M proteinand 50 mM ammonium acetate (Fig. 8B), the spectrum showssignals of LptC monomers and dimers. Mass deconvolutiongives a value of 20,536.8 (�0.25) Da for the monomer and41,073.9 (�1.02) Da for the dimer which are in close agree-ment with the values calculated from the amino acid sequence(20,535.85 Da for the monomer and 41,071.7 Da for thedimer). Both species are characterized by conformational het-erogeneity, as indicated by multimodal charge-state distribu-tions (15), with maxima at 10�, 15�, and 23� for the mono-mer and at 14� and 21� for the dimer. A 10-fold increase inthe ionic strength results in a simpler spectrum, with only onemonomeric and one dimeric species centered, respectively, onthe 10� and 14� ions (Fig. 8C). This result suggests that theconformational heterogeneity observed at a lower ionicstrength might reflect partial protein unfolding induced by theexperimental conditions used. In Fig. 8D, the effect of proteinconcentration on the spectrum at high ionic strength is shown.

monitored by measuring the OD600. Samples for protein and LPS analyses were taken from cells grown in the presence (�ara) or absence (�ara)of arabinose at 240 (wt, FL905, and FL905/pGS103) or 270 min (FL905/pGS103G56V, FL905/pGS108G153R, and FL905/pGS103�177-191) afterthe shift into fresh medium. (B) Steady-state levels of LptA, LptC, and LptE and LPS profile. Protein samples were subjected to Western blotanalysis with anti-LptA, anti-LptC, anti-LptE, and anti-AcrB (as a loading control) antibodies. Anti-LptE antibodies cross-react with LptC-H Histag (�). Total LPS was extracted from mutant cells grown in the same conditions and at the same time points of protein analysis. LPS extractedfrom cultures with a total OD600 of 2 were separated by 18% Tricine-SDS-PAGE and silver stained. Equal amounts of cells, based on the ODmeasurement (0.2 OD600 units for protein analysis, 0.4 for LPS analysis), were loaded into each lane.

FIG. 6. LptC dimerization in vivo. Wild-type strain AM604 cellstransformed with different LptC constructs were treated with the cross-linking DSP agent in vivo. Cell extracts were prepared and analyzed byWestern blotting with anti-LptC and anti-LptA antibodies. Sampleswere treated with �-mercaptoethanol (�-ME) to revert the cross-link-ing. Equal amount of cells, (1.6 OD600 units) was loaded into eachlane. An asterisk (�) labels a band that cross-reacts with the anti-LptCantibody.

FIG. 7. Steady-state levels of LptA and LptC upon LptE depletion.Protein samples from AM689 cells transformed with various plasmidsand grown in the presence (�) or absence (�) of arabinose 180 minafter a shift in the nonpermissive condition were analyzed by Westernblotting with anti-LptA, anti-LptC, and anti-LptE antibodies. Equalamounts of cells (0.2 OD600 units) were loaded into each lane. AcrBwas used as a loading control.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

The relative intensity of the monomer decreases as the proteinconcentration is increased from 5 to 20 �M, a finding consis-tent with a monomer-dimer equilibrium in the original liquidsample. The calculated relative amount of the dimer is 70%.These data provide direct evidence of a predominant dimericstate of LptC in solution. However, it should be underscoredthat the apparent dissociation constant (in the micromolarrange, according to these results) could be affected by thepeculiar conditions imposed by electrospray. Overall, thesedata suggest that the LptC dimerizes and that the solubleportion of the protein is sufficient to promote dimerization.

Effect of LptD and LptE depletion on Lpt complex assembly.The experiments described above showed that the steady-statelevel of LptA is affected in the absence of wild-type LptC or bythe �177-191 mutation, which severely impairs LptC�177-191 sta-bility. It is possible that the absence of a proper IM dockingstructure for LptA results in LptA degradation in vivo. There-fore, the LptA level in the cell could be diagnostic of theproperly bridged IM and OM. We thus tested whether theabsence of the OM LptDE complex could also exert a similareffect on LptA stability. The AM661 and AM689 strains, inwhich the LptD and LptE expression is driven by the induciblearaBp promoter (29), were grown under permissive conditionsto exponential phase and then shifted to media lacking arabi-nose to deplete LptD and LptE, respectively. Samples forprotein analyses were taken from cultures grown in the pres-

ence or in the absence of arabinose 210 min after the shift tononpermissive conditions (Fig. 9A) and then processed forWestern blot analysis with anti-LptA, anti-LptE, and anti-AcrB antibodies. As shown in Fig. 9B, a decreased steady-statelevel of LptA is observed upon LptE and LptD depletion.Overall, our data suggest that when the Lpt machinery is notfunctional for lack of either IM or OM components, LptA isdestabilized, probably because it is not properly assembled inthe Lpt complex.

DISCUSSION

LptA interaction with IM and OM Lpt components. The Lptproteins constitute a machinery for LPS transport to the cellsurface. Genetic and biochemical evidence indicates that thecomponents of the machinery work in a concerted way. In fact,upon depletion of any of the seven Lpt proteins, the LPSassembly pathway is blocked in nearly the same fashion (23,29); moreover, it has been recently shown that the seven Lptproteins physically interact and constitute a transenvelopecomplex connecting IM and OM (4). However, little is knownabout how specific Lpt factors interact with each other. Weshow here by copurification experiments that in vivo LptAbinding to IM occurs through binding to LptC, although wecannot rule out the possibility that LptA may also interact with

FIG. 8. LptC dimerization in vitro. (A) Apparent molecular weight (MW) of LptC as determined by gel filtration. The relative elution volumeof sH-LptC in 50 mM sodium phosphate (pH 8.0)–100 mM NaCl was compared to that of globular standards. The chromatogram is shown in theinset. Trf, transferrin; Ov, ovalbumin; Chy, chymotrypsin; Cytc, cytochrome c; Apr, aprotinin; Ve, elution volume; Vo, void volume; Abs, absorbanceat 280 nm. (B, C, and D) Quaternary structure of LptC by mass spectrometry. The nano-ESI-MS spectra of 5 �M LptC in 50 mM ammoniumacetate (pH 7.5) (B), 5 �M LptC in 500 mM ammonium acetate (pH 7.5) (C), and 20 �M LptC in 500 mM ammonium acetate (pH 7.5) (D) areshown. The main charge state of each peak envelope is labeled by the corresponding number of charges. Dimer-specific peaks are labeled by doublecircles. Solid symbols correspond to compact dimers, and open symbols correspond to less compact dimers.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

other IM components such as LptFG, which possess periplas-mic loops (23).

LptC depletion results in a significant decrease of LptAlevel. Similarly, the LptA level in the cells decreases uponLptD or LptE depletion, strongly suggesting that LptA alsointeracts with the LptDE complex at the OM and that in anon-properly assembled Lpt complex LptA may be degraded.It is likely that LptC and the LptDE complex play a structuralrole and prevent LptA degradation. Instability and/or degra-dation of components of protein complexes when proven orproposed interacting partners are either depleted or not func-tional is not unusual and provides indirect evidence of physicaland functional interaction. The loss of any protein of thePilMNOP IM complex required for biogenesis of type IV piliin Pseudomonas aeruginosa results in instability of the otherinteracting partners (1); similarly, EspL and EspM, which be-long to the type II secretion pathway required for cholera toxinsecretion in Vibrio cholerae, have been shown to participate inmutual stabilization by protecting each other from proteolysis(25). Finally, Chng and coworkers demonstrated that LptD canonly be overexpressed with LptE and that purified LptE isresistant to proteolytic degradation when in complex withLptD, thus indicating a structural role of LptE in stabilizingthe folded state or facilitating the folding and assembly ofLptD (5).

Interaction of LptA with LptC and the LptDE complexsupports the model proposed by Kahne and coworkers (4),which posits that LptA interacts with both the IM and the OM.Consistent with this model are previous findings showing thatin the crystals obtained in the presence of LPS, the LptAmonomers are packed as a linear filament (34), suggesting that

LptA oligomerization is functional to bridging the IM and OM.Since LptA consists of a conserved domain also found in theN-terminal periplasmic domain of LptD, we suggest that thelatter protein may be the docking site for LptA at the OM (2,30) and thus that LptA is anchored to the IM and OM throughLptC and LptD, respectively.

LptC structure-function relationship. The analysis of loss-of-function mutations in lptC allowed us to further support thestructural role of LptC-LptA interaction in preventing LptAdegradation and to define functional regions in the LptC pro-tein. The LptCG56V substitution falls in a stretch of relativelyconserved residues and, based on the recently reported crystalstructure, this residue is contained in one of the two disorderedregions of the protein (residues 24 to 58) where no electrondensity was observed (38). The G56V amino acid substitutiondoes not abolish interaction with LptA and in cells expressingLptCG56V the LptA level seems even higher than thatobserved in cells expressing wild-type LptC. However,LptCG56V impairs LPS transport, as demonstrated by thedecreased viability and the appearance of LPS decorated withcolanic acid in cells expressing the mutant protein only. Thesedata suggest that this mutation does not affect IM and OMbridging by the Lpt complex, although the complex is notfunctional. Since LptC has been shown to bind LPS in vitro(38), it may be possible that the G56V mutation impairs suchbinding. An alternative hypothesis can be that during LPStransport LptC may undergo conformational changes, as sug-gested by the recently reported crystal structure analysis (38),that could be compromised by the G56V mutation.

The LptCG153R mutant protein displays a reduced affinityto LptA since it is not able to copurify LptA. As for LptCG56,

FIG. 9. LptA level upon LptD and LptE depletion. (A and B) Growth curves of AM661 (araBp-lptD [A]) and AM689 (araBp-lptE [B]). Cellsgrowing exponentially in LD containing arabinose were harvested, washed, and subcultured in arabinose-supplemented (}) or arabinose-free (�)medium. Growth was monitored by measuring the OD600. (C) Steady-state levels of LptA. Samples for protein analysis taken from cells grown inthe presence (�) or absence (�) of arabinose at 210 min after the shift into nonpermissive condition were analyzed by Western blotting withanti-LptA and anti-LptE antibodies. Equal amounts of cells (0.2 OD600 units) were loaded into each lane. AcrB was used as the loading control.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

G153 also falls in a stretch of conserved residues (38). Theinability of LptCG153R to copurify LptA suggests that thebinding determinants are located in the C-terminal region ofthe protein. In cells expressing LptC� or LptCG153R, theLptA level is comparable, suggesting that the residual bindingactivity of LptCG153R mutant protein, overexpressed from aplasmid, is sufficient to prevent LptA degradation. Neverthe-less, LptC�-depleted FL905 cells expressing LptCG153R arenot viable (Fig. 2B) and accumulate colanic acid decoratedLPS (Fig. 5B), which indicates that transport is impaired.

LptC�177-191 is highly unstable (Fig. 3A) and fails to interactwith LptA (Fig. 4), and thus the assembly of the Lpt complexis compromised. Interestingly, the C-terminal deletion ofLptC�177-191 removes the second disordered region of the pro-tein (residues 185 to 191) (38). It is well established that un-folded or only partly folded proteins in their native states foldinto an ordered structure on binding a partner molecule/pro-tein (7, 8). A well-studied example is the binding of colicins todisordered regions of their OM receptors as a key step in theirtranslocation into the target cell (12, 37). Therefore, the in-trinsically disordered region in the C-terminal end of LptC(residues 185 to 191) might be reorganized and folded uponbinding to LptA.

We show here that in the Lpt machinery, LptC interacts withLptA. The recently solved crystal structure of LptC reveals astriking structural similarity to LptA despite the fact that thetwo proteins do not share sequence similarity (38). LptC is alsopart of the LptBCFG complex (18). A possible candidatefor interaction in this complex is LptF since its periplasmicloop displays a structural similarity to LptC (http://zhang.bioinformatics.ku.edu/I-TASSER/). We provide evidencehere that LptC, when overexpressed, is also able to dimerize invivo (Fig. 6A). In addition to the in vivo data, size-exclusionchromatography and ESI-MS experiments showed that a sol-uble LptC version missing the N-terminal transmembrane do-main (sH-LptC) forms dimers in vitro whose abundance in-creases with increasing protein concentration and ionicstrength. In a very recent study it was reported that LptC existsas a monomer in solution (38). It is possible that this discrep-ancy is due to the different approaches and experimental con-ditions used. However, we suggest that the dimeric form is notthe physiological preferred state in wild-type cells and that inthe Lpt complex a single LptC molecule is present; our datasuggest that LptC overexpression in vivo may shift the equilib-rium between heterodimerization (interaction with LptAand/or LptF in the LptBFG complex) and homodimerization.It has been shown that the relative stoichiometry of the IMPilM/N/O/P proteins is crucial in promoting pilus assembly inP. aeruginosa. When overexpressed, PilO may form ho-modimers. However, the heterodimer PilN/O is the physiolog-ically preferred state, occurring when PilO is expressed fromthe chromosome (1). The subunit ratio of the LptBCFG com-plex (LptB/LptF/LptG/LptC) has been proposed to be 2:1:1:1(predicted molecular mass of 157.2 kDa) (18). However, themolecular mass of the LptBCFG complex determined by size-exclusion chromatography was 330 kDa (18), which would beconsistent with the ability of LptC to interact with itself, thusresulting in dimerization of LptBCFG complex.

As discussed above, the LptC�177-191 truncated protein isintrinsically unstable, since it may expose unfolded regions and

become a protease substrate (40). Alternatively, LptC�177-191

could not associate with the LptBFG complex and might thusbe degraded in the periplasm. In fact, it has been reported thatunbalanced expression of LptB in an LptFG wild-type back-ground results in the loss of IM association and the degrada-tion of soluble LptB molecules in the cytoplasm (18). LptCcould also be also stabilized by the interaction with LptA, thelevel of which does indeed increase when the LptC� depletionstrain FL905 is grown with arabinose. A similar codependencehas been observed for the IM divisome subcomplex FtsB/FtsL/FtsQ, where it has been shown that FtsL and FtsB are code-pendent for stabilization (10). However, our data (Fig. 7) sug-gest that the stability of LptC does not depend on LptA. Infact, upon LptE depletion LptA is undetectable since the OMdocking site is missing, but the LptC level is not affected.

In conclusion, we provide evidence here that depletion ofLptC, LptD, LptE, or mutations in LptC abolishing its functionbreak the Lpt machinery by impairing either its assembly(LptC�177-191) or functionality (LptCG153R and LptCG56V).The lack of LptC (because the protein is depleted or mutated)or LptDE removes the IM and OM LptA docking sites, andthe LptA level in the cell decreases. Based on these data, wesuggest that the steady-state level of LptA is controlled at theprotein stability level by the assembly of the Lpt complex sincethe inability of the protein to properly interact with IM andOM docking sites results in its degradation. Therefore, theLptA level could be used as a marker of properly bridged IMand OM components. Our genetic and biochemical data con-firm that LptC plays a key role in docking LptA and other Lptfactors at the IM, in addition to a direct role in LPS transport,since the protein has also been shown to bind LPS (38). Over-all, the data presented here strongly support the transenvelopecomplex model for LPS transport.

ACKNOWLEDGMENTS

We are grateful to Daniel Kahne for providing the LptC and LptDantibodies. We thank K. M. Pos for providing the AcrB antibodies. Wealso thank Chiara Raimondi for excellent technical assistance.

This study was supported in part by MIUR (Ministerodell’Istruzione Universita e Ricerca) grant PRIN 200824M2HX (A.P.)and Regione Lombardia Cooperazione Scientifica e Tecnologica In-ternazionale grant 16876 SAL-18 (A.P.).

REFERENCES

1. Ayers, M., et al. 2009. PilM/N/O/P proteins form an inner membrane com-plex that affects the stability of the Pseudomonas aeruginosa type IV pilussecretin. J. Mol. Biol. 394:128–142.

2. Bos, M. P., V. Robert, and J. Tommassen. 2007. Biogenesis of the Gram-negative bacterial outer membrane. Annu. Rev. Microbiol. 61:191–214.

3. Bos, M. P., B. Tefsen, J. Geurtsen, and J. Tommassen. 2004. Identificationof an outer membrane protein required for the transport of lipopolysaccha-ride to the bacterial cell surface. Proc. Natl. Acad. Sci. U. S. A. 101:9417–9422.

4. Chng, S. S., L. S. Gronenberg, and D. Kahne. 2010. Proteins required forlipopolysaccharide assembly in Escherichia coli form a transenvelope com-plex. Biochemistry 49:4565–4567.

5. Chng, S. S., N. Ruiz, G. Chimalakonda, T. J. Silhavy, and D. Kahne. 2010.Characterization of the two-protein complex in Escherichia coli responsiblefor lipopolysaccharide assembly at the outer membrane. Proc. Natl. Acad.Sci. U. S. A. 107:5363–5368.

6. Doerrler, W. T., H. S. Gibbons, and C. R. Raetz. 2004. MsbA-dependenttranslocation of lipids across the inner membrane of Escherichia coli. J. Biol.Chem. 279:45102–45109.

7. Dyson, H. J., and P. E. Wright. 2002. Coupling of folding and binding forunstructured proteins. Curr. Opin. Struct. Biol. 12:54–60.

8. Dyson, H. J., and P. E. Wright. 2005. Intrinsically unstructured proteins andtheir functions. Nat. Rev. Mol. Cell. Biol. 6:197–208.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

9. Eom, G. T., J. K. Song, J. H. Ahn, Y. S. Seo, and J. S. Rhee. 2005. Enhance-ment of the efficiency of secretion of heterologous lipase in Escherichia coliby directed evolution of the ABC transporter system. Appl. Environ. Micro-biol. 71:3468–3474.

10. Gonzalez, M. D., and J. Beckwith. 2009. Divisome under construction: dis-tinct domains of the small membrane protein FtsB are necessary for inter-action with multiple cell division proteins. J. Bacteriol. 191:2815–2825.

11. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plas-mids. J. Mol. Biol. 166:557–580.

12. Hecht, O., H. Ridley, J. H. Lakey, and G. R. Moore. 2009. A commoninteraction for the entry of colicin N and filamentous phage into Escherichiacoli. J. Mol. Biol. 388:880–893.

13. Heck, A. J., and R. H. Van Den Heuvel. 2004. Investigation of intact proteincomplexes by mass spectrometry. Mass Spectrom. Rev. 23:368–389.

14. Invernizzi, G., A. Natalello, M. Samalikova, and R. Grandori. 2007. Protein-protein and protein-ligand interactions studied by electrospray-ionizationmass spectrometry. Protein Pept. Lett. 14:894–902.

15. Kaltashov, I. A., and R. R. Abzalimov. 2008. Do ionic charges in ESI MSprovide useful information on macromolecular structure? J. Am. Soc. MassSpectrom. 19:1239–1246.

16. Ma, B., C. M. Reynolds, and C. R. Raetz. 2008. Periplasmic orientation ofnascent lipid A in the inner membrane of an Escherichia coli LptA mutant.Proc. Natl. Acad. Sci. U. S. A. 105:13823–13828.

17. Miyake, K. 2004. Innate recognition of lipopolysaccharide by Toll-like re-ceptor 4-MD-2. Trends Microbiol. 12:186–192.

18. Narita, S., and H. Tokuda. 2009. Biochemical characterization of an ABCtransporter LptBFGC complex required for the outer membrane sorting oflipopolysaccharides. FEBS Lett. 583:2160–2164.

19. Polissi, A., and C. Georgopoulos. 1996. Mutational analysis and properties ofthe msbA gene of Escherichia coli, coding for an essential ABC familytransporter. Mol. Microbiol. 20:1221–1233.

20. Raetz, C. R., et al. 2009. Discovery of new biosynthetic pathways: the lipid Astory. J. Lipid Res. 50(Suppl.):S103–S108.

21. Raetz, C. R., and C. Whitfield. 2002. Lipopolysaccharide endotoxins. Annu.Rev. Biochem. 71:635–700.

22. Reuhs, B. L., R. W. Carlson, and J. S. Kim. 1993. Rhizobium fredii andRhizobium meliloti produce 3-deoxy-D-manno-2-octulosonic acid-containingpolysaccharides that are structurally analogous to group II K antigens (cap-sular polysaccharides) found in Escherichia coli. J. Bacteriol. 175:3570–3580.

23. Ruiz, N., L. S. Gronenberg, D. Kahne, and T. J. Silhavy. 2008. Identificationof two inner-membrane proteins required for the transport of lipopolysac-charide to the outer membrane of Escherichia coli. Proc. Natl. Acad. Sci.U. S. A. 105:5537–5542.

24. Sabbattini, P., F. Forti, D. Ghisotti, and G. Deho. 1995. Control of tran-scription termination by an RNA factor in bacteriophage P4 immunity:identification of the target sites. J. Bacteriol. 177:1425–1434.

25. Sandkvist, M., L. P. Hough, M. M. Bagdasarian, and M. Bagdasarian. 1999.Direct interaction of the EpsL and EpsM proteins of the general secretionapparatus in Vibrio cholerae. J. Bacteriol. 181:3129–3135.

26. Sklar, J. G., T. Wu, D. Kahne, and T. J. Silhavy. 2007. Defining the roles ofthe periplasmic chaperones SurA, Skp, and DegP in Escherichia coli. GenesDev. 21:2473–2484.

27. Sperandeo, P., et al. 2007. Characterization of lptA and lptB, two essential

genes implicated in lipopolysaccharide transport to the outer membrane ofEscherichia coli. J. Bacteriol. 189:244–253.

28. Sperandeo, P., G. Deho, and A. Polissi. 2009. The lipopolysaccharide trans-port system of Gram-negative bacteria. Biochim. Biophys. Acta 1791:594–602.

29. Sperandeo, P., et al. 2008. Functional analysis of the protein machineryrequired for transport of lipopolysaccharide to the outer membrane of Esch-erichia coli. J. Bacteriol. 190:4460–4469.

30. Sperandeo, P., C. Pozzi, G. Deho, and A. Polissi. 2006. Non-essential KDObiosynthesis and new essential cell envelope biogenesis genes in the Esche-richia coli yrbG-yhbG locus. Res. Microbiol. 157:547–558.

31. Sprott, G. D., G. Ferrante, and I. Ekiel. 1994. Tetraether lipids of Methano-spirillum hungatei with head groups consisting of phospho-N,N-dimethyl-aminopentanetetrol, phospho-N,N,N-trimethylaminopentanetetrol, and car-bohydrates. Biochim. Biophys. Acta 1214:234–242.

32. Steeghs, L., et al. 1998. Meningitis bacterium is viable without endotoxin.Nature 392:449–450.

33. Stenberg, F., et al. 2005. Protein complexes of the Escherichia coli cellenvelope. J. Biol. Chem. 280:34409–34419.

34. Suits, M. D., P. Sperandeo, G. Deho, A. Polissi, and Z. Jia. 2008. Novelstructure of the conserved Gram-negative lipopolysaccharide transport pro-tein A and mutagenesis analysis. J. Mol. Biol. 380:476–488.

35. Tefsen, B., J. Geurtsen, F. Beckers, J. Tommassen, and H. de Cock. 2005.Lipopolysaccharide transport to the bacterial outer membrane in sphero-plasts. J. Biol. Chem. 280:4504–4509.

36. Thanabalu, T., E. Koronakis, C. Hughes, and V. Koronakis. 1998. Substrate-induced assembly of a contiguous channel for protein export from Esche-richia coli: reversible bridging of an inner-membrane translocase to an outermembrane exit pore. EMBO J. 17:6487–6496.

37. Tozawa, K., et al. 2005. Clusters in an intrinsically disordered protein createa protein-binding site: the TolB-binding region of colicin E9. Biochemistry44:11496–11507.

38. Tran, A. X., C. Dong, and C. Whitfield. 2010. Structure and functionalanalysis of LptC, a conserved membrane protein involved in the lipopoly-saccharide export pathway in Escherichia coli. J. Biol. Chem. 285:33529–33539.

39. Tran, A. X., M. S. Trent, and C. Whitfield. 2008. The LptA protein ofEscherichia coli is a periplasmic lipid A-binding protein involved in thelipopolysaccharide export pathway. J. Biol. Chem. 283:20342–20349.

40. Wickner, S., M. R. Maurizi, and S. Gottesman. 1999. Posttranslational qual-ity control: folding, refolding, and degrading proteins. Science 286:1888–1893.

41. Wu, T., et al. 2006. Identification of a protein complex that assembles lipo-polysaccharide in the outer membrane of Escherichia coli. Proc. Natl. Acad.Sci. U. S. A. 103:11754–11759.

42. Zgurskaya, H. I., and H. Nikaido. 2000. Cross-linked complex betweenoligomeric periplasmic lipoprotein AcrA and the inner-membrane-associ-ated multidrug efflux pump AcrB from Escherichia coli. J. Bacteriol. 182:4264–4267.

43. Zhou, Z., K. A. White, A. Polissi, C. Georgopoulos, and C. R. Raetz. 1998.Function of Escherichia coli msbA, an essential ABC family transporter, inlipid A and phospholipid biosynthesis. J. Biol. Chem. 273:12466–12475.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

b on

03

Janu

ary

2022

by

14.2

13.1

35.4

3.

1 new insights into the lpt machinery for lps transport to the cell

Documents