1

Identification of the binding site for the Lutheran blood group glycoprotein on laminin 5

through expression of chimeric laminin chains in vivo

Yamato Kikkawa1, Casey L. Moulson1, Ismo Virtanen3, and Jeffrey H. Miner1,2*

From the 1Renal Division, Department of Internal Medicine and 2Department of Cell Biology

and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110,

3Institute of Biomedicine/Anatomy, Biomedicum Helsinki, University of Helsinki, Helsinki,

Finland

Running title: Identification of the Lutheran binding site on laminin α5

*Address correspondence to:Jeffrey H. MinerWashington University School of MedicineRenal Division, Box 8126660 South Euclid AvenueSt. Louis, MO63110Tel: 314-362-8235Fax: 314-362-8237E-mail: minerj@pcg.wustl.edu

Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on September 18, 2002 as Manuscript M208731200 by guest on A

pril 12, 2018http://w

ww

.jbc.org/D

ownloaded from

2

SUMMARY

The Lutheran blood group glycoprotein (Lu), also known as basal cell adhesion molecule

(B-CAM), is an Ig superfamily transmembrane receptor for laminin α5. Lu is expressed on the

surface of a subset of muscle and epithelial cells in diverse tissues and is thought to be involved

in both normal and disease processes, including sickle cell disease and cancer. Here we

investigated the binding of Lu to laminin α5 in vivo and in vitro. We prepared a soluble

recombinant Lu (sol-Lu) composed of the Lu extracellular domain and a 6xHis tag. Sol-Lu

bound specifically to laminin-10/11 (α5β1/β2γ1) in ELISAs and bound to bona fide basement

membranes containing laminin α5 in tissue sections. Sol-Lu did not bind to tissue sections of

laminin α5 knockout embryos, despite the fact that the four other α chains were present. To

identify the Lu binding site on laminin α5, we prepared modified α5 cDNAs encoding chimeric

laminins containing all or part of the laminin α1 G domain in place of the analogous α5 regions.

These constructs were used to generate transgenic mice. Proteins derived from transgenes were

detected in basement membranes and were assayed for their ability to bind Lu by examining the

localization of endogenous Lu and the binding of sol-Lu applied to tissue sections. Our results

demonstrate that the α5 LG3 module is essential for Lu binding to laminin α5.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

INTRODUCTION

Laminins are a family of extracellular matrix proteins that are located primarily in

basement membranes. They regulate various cellular functions such as adhesion, motility,

growth, differentiation, and apoptosis through interaction with specific cell surface receptors

(1,2). The three subunits of laminins, designated α, β, and γ chains, assemble to form what is

typically a cross-shaped structure. Five α, four β, and three γ chains have been identified. To

date, 15 different laminin heterotrimers have been found to be synthesized and secreted by cells

(3-7), although many more combinations are theoretically possible. Of the three laminin chain

types, only the α chain has a large carboxyl-terminal globular (G)1 domain consisting of a

tandem array of five laminin-type G (LG) modules (LG1 thru LG5) (8). These LG modules

contain binding sites for β1 integrins and heparin, as well as α-dystroglycan in some isoforms

(9).

The laminin α5 chain is a component of the laminin-10 (α5β1γ1) and laminin-11

(α5β2γ1) heterotrimers and is widely expressed (4,10-12). We have shown that mice lacking

laminin α5 die during late embryogenesis with several developmental defects, including defects

in neural tube closure, digit separation, placentation, and kidney and lung development (13-15).

Laminin-10/11 is bound by several different receptors, including integrin α3β1, α6β1, and α6β4

(16,17) and dystroglycan (18). Another potential non-integrin receptor for laminin α5 is the

Lutheran blood group glycoprotein (Lu), which is a member of the Ig superfamily. A splice

variant of Lu is known as basal cell adhesion molecule (B-CAM) (19,20). Lu/B-CAM has been

studied primarily in the contexts of blood group antigens, sickle cell disease, and cancer (20-26).

Lee et al. have proposed that sickle red blood cells adhere to endothelial basement membranes by

binding to laminin α5. They showed that sickle cells bind to laminin preparations containing the

α5 chain, and an antibody to laminin α5 inhibits binding (26). Udai et al. demonstrated that the

major laminin receptor present on sickle cells is the Lu/B-CAM protein (25). Furthermore, K562

cells transfected with human Lu adhere to laminin-10/11 but not to laminins lacking the α5 chain

(27). In our previous studies we made an antibody specific for mouse Lu and determined its

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

expression pattern (28). Lu is expressed on the surface of a subset of muscle and epithelial cells

in diverse tissues. In epithelial cells, Lu is concentrated on the basal surface adjacent to

basement membranes containing laminin α5. In Lama5 -/- tissues, Lu is no longer localized to

the basal surface, suggesting that Lu binds directly to α5. In transgenic mouse hearts that

overexpress laminin α5, Lu levels are elevated, suggesting that the increased α5 in

cardiomyocyte basement membranes recruits additional Lu to the cell surface through a direct

interaction. Although the laminin binding site on Lu has been mapped to a first approximation

(20,27,29), there is little insight into the structural basis for Ig superfamily members binding to

laminins. To better understand the interaction between Lu and the laminin α5 chain, it is

important to determine the site of Lu binding on α5.

In this study we prepared a soluble recombinant protein containing the Lu extracellular

domain (sol-Lu). Sol-Lu bound to laminin-10/11 in ELISAs and specifically recognized the

laminin α5 chain on tissue sections. To identify the binding site for Lu on the laminin α5 chain

in vivo, we produced transgenic mice expressing modified laminin α5 chains with LG module

substitutions derived from laminin α1. These chimeric α chains incorporated into basement

membranes; sol-Lu was then used in tissue binding assays to narrow the Lu binding site on α5 to

the LG3 module.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

EXPERIMENTAL PROCEDURES

Proteins and antibodies

Mouse laminin-1 (α1β1γ1) and human laminin-10/11 (α5β1/β2γ1) were purchased from

Invitrogen (Carlsbad, CA). Monoclonal antibody against human Lu (BRIC108) was purchased

from Biogenesis (Kingston, NH). Monoclonal antibody against human laminin α1 LG4-5

(163DE4) has been previously described (30). Polyclonal antibodies against laminin α2 (31) and

laminin-5 (α3β3γ2) (32) were gifts from Drs. Peter D. Yurchenco (Robert Wood Johnson

Medical School, Piscataway, NJ) and M. Peter Marinkovich (Stanford University, Stanford, CA),

respectively. Polyclonal antibodies against domain VI/V of mouse laminin α1 chain (33) and

domain IIIa of mouse laminin α4 chain (34) have been described. The production of rabbit

antibodies against recombinant LG4-5 of mouse laminin α5 chain followed the procedures used

before for α2LG4-5 (35). Drs. Rupert Timpl and Takako Sasaki (Max-Planck-Institute for

Biochemistry, Martinsried, Germany) provided these three antibodies. Polyclonal antiserum

against domain IIIb/IVa of mouse laminin α5 has been described (4). To produce a recombinant

immunogen containing the cytoplasmic tail of mouse Lu, the cDNA segment encoding amino

acids 564-622 (GenBank accession number AF346663) was cloned into pGEX-5X-3 vector

(Pharmacia, Uppsala, Sweden) to generate a glutathione-S-transferase fusion protein. The fusion

protein was purified on glutathione beads according to the manufacturer’s instructions. Rabbits

were immunized with the fusion protein by standard methods at Harlan (Indianapolis, IN). The

resulting antiserum stained tissues in the same fashion as our previous antiserum (28) but did not

require urea denaturation of the tissue for immunoreactivity.

Preparation of sol-Lu

A cDNA expression plasmid containing the full length human Lu coding region, a V5

tag, and a 6XHis tag was purchased from Invitrogen. To remove sequences encoding the V5 tag

and the transmembrane and intracellular domains, nucleotides 904-1668 (GenBank accession

number X83425) were amplified by polymerase chain reaction (PCR) with Vent polymerase

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

(New England Biolabs, Beverly, MA) following the manufacturer’s instructions and using the

primer combination: sense: 5’-GGCAGCCCCAGCCCGGAGTAT-3’; antisense 5’-

GGAATTCACCGGTCACTCCAGCCTGGGAGGTCTG-3’. The amplified fragment was

digested and then ligated into the XhoI and AgeI sites of the expression vector. The resulting

expression vector containing the Lu extracellular domain and a 6xHis tag was transfected into

COS-7 cells (American Type Culture Collection, Manassas, VA) using Lipofectamine

(Invitrogen). Cells were grown in DMEM supplemented with 10% fetal calf serum (Life

Technologies, Gaithersburg, MD). The recombinant protein was purified from serum-free

culture medium by nickel column chromatography. The eluted fractions were pooled and

dialyzed against Ca2+ and Mg2+ -free phosphate-buffered saline (PBS(-)). The purity of

recombinant protein was defined by SDS-PAGE (Fig. 1).

In vitro binding assays

Binding assays were carried out with various concentrations (0 - 80 µg) of laminin-10/11

and laminin-1 coated onto the plastic surface of microtiter plates. Plates were blocked with 1%

BSA in PBS(-) and incubated with sol-Lu at 37 OC for 1 hour. After washing with PBS(-), the

bound sol-Lu was detected with a human Lu-specific monoclonal antibody, BRIC108. After

further washing, the bound antibodies were detected by addition of horseradish-peroxidase

conjugated anti-mouse IgG1 (Roche Diagnostic, Indianapolis, IN), followed by addition of

1mg/ml o-phenylendiamine and 0.001% H2O2. The absorbance was measured at 492 nm by

VERSAmax (Molecular Devices, Sunnyvale, CA).

Preparation of chimeric laminin constructs

cDNA clones encoding full length mouse laminin α5 (generated in our laboratory) and

human laminin α1 (provided by Dr. Karl Tryggvason, Stockholm, Sweden) chains were used to

construct expression vectors encoding the chimeric laminin α chains Mr51, Mr5G2, and Mr5G3.

PCR was used to introduce restriction sites at appropriate locations and to seamlessly join

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

amplified fragments with overlapping sequences by sequential PCR (36). For all PCR, Vent

polymerase (New England Biolabs) was used according to the manufacturer’s instructions. To

construct Mr51, a BsiWI site was first engineered at the junction between α5 domain I/II and G.

The G domain of human α1 was amplified with primers containing added BsiWI sites: sense:

5’-CGGGATCCCGTACGCAAGCAGCTTCTATTAAAGTCGCCG-3’ and antisense: 5’-

GCTCTAGACGTACGGGCGCGCCTCAGGACTCGGTCCCAGGAC-3’. This product was

ligated to the cDNA encoding α5 domains VI through I/II. For generating Mr5G2 and Mr5G3,

we took advantage of a unique AgeI site at the end of α5G1. To construct Mr5G2, α5LG2 was

amplified with: sense: 5’-AAGCGCGCCTCTAGAGGGCGTTCAGGGGTACGACTG-3’, and

antisense:5’-GAAGCTAACACTTCCCACTAGCAGGTCAGCGGT-3’; α1LG3-5 was

amplified with: sense: 5’-CTGCTAGTGGGAAGTGTTAGCTTCCTGAAAGGC-3’, and

antisense: 5’- AGGCGCGCCCGTACGTCAGGACTCGGTCCCAGGAC -3’. These two

products were mixed and subjected to PCR again for 20 cycles to join them. To construct

Mr5G3, α5LG2-3 was amplified with: sense: same primer as for α5LG2, and antisense: 5’-

CCGGGGCTCTCTGGCTGGTGTACAGCCTACGCT-3’; α1LG4-5 was amplified with: sense:

5’-TGTACACCAGCCAGAGAGCCCCGGGCTTTTCCA-3’, and antisense: same as α1LG3-5.

These two products were mixed and subjected to PCR again for 20 cycles to join them. The

segments encoding chimeric LG2-5 modules were ligated to the cDNA encoding α5 domains VI

through LG1 to generate full length chimeric cDNAs. These were then cloned into a modified

widely active expression vector miw (Suemori et al., 1990), which contains a fusion of the

chicken β-actin promoter and the Rous sarcoma virus long terminal repeat.

Generation of knockout and transgenic mice

Production of Lama5 mutant mice and transgenic mice overexpressing full length laminin

α5 has been described (13,28). Transgenic mice expressing chimeric laminins were produced by

the Mouse Genetics Core facility at Washington University School of Medicine by standard

microinjection of DNA into pronuclei of (B6XCBA)F2 single-celled embryos. The desired

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

transgenes were separated from plasmid vector sequences by digestion with NotI and agarose gel

electrophoresis.

Immunohistochemistry

Mouse embryos from timed matings were frozen whole by immersing in OCT compound

and quick-freezing in 2-methylbutane cooled in a dry ice-ethanol bath. Sections were cut at 7

µm in a cryostat and air-dried. For staining, sections were blocked in 10% normal goat serum

and then incubated with primary antibody. All antibody incubations were in PBS containing 1%

BSA, and all washes were in PBS. Secondary antibodies were conjugated to fluorescein

isothiocyanate (ICN, Costa Mesa, CA) or Cy3 (Chemicon, Temecula, CA). After several

washes, sections were mounted in 90% glycerol containing 0.1XPBS and 1 mg/ml p-

phenylenediamine. Sections were examined through a Nikon Eclipse E800 microscope. Images

were captured with a Spot 2 cooled color digital camera (Diagnostic Instruments, Sterling

Heights, MI) using Spot Software Version 2.1. Images were imported into Adobe Photoshop 5.0

and Adobe Illustrator 9.0 for processing and layout.

Sol-Lu binding assay on tissue sections

Sol-Lu was adjusted to 10 µg/ml with 1% BSA/PBS(-). Sections were blocked in 10%

normal goat serum, and incubated with diluted sol-Lu. Bound sol-Lu was detected with a

monoclonal antibody against human Lu (BRIC108) and methods described above.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

RESULTS

Production of recombinant sol-Lu protein and its binding to laminin-10/11

To examine the binding of Lu to laminin α5, we prepared a soluble recombinant protein

that is composed of the Lu extracellular domain and a COOH-terminal 6xHis tag. As shown in

Figure 1A, the purified recombinant protein (sol-Lu) migrated as a single band in SDS-PAGE.

The identity of the purified protein was further defined by ELISA using a monoclonal antibody

against human Lu (data not shown).

To test if sol-Lu binds to laminin-10/11 (α5β1/β2γ1) we performed solid phase binding

assays. Bound sol-Lu was detected by monoclonal antibody against human Lu. The binding of

Lu to laminin-10/11 was observed at >5 µg/ml of coating concentration (Fig. 1B). On the other

hand, sol-Lu did not bind to laminin-1 (α1β1γ1). This specificity for laminins containing the α5

chain is consistent with published results (20,27). We therefore conclude that sol-Lu has binding

properties similar to native cell surface Lu and is an appropriate tool to investigate and identify

Lu binding sites on the laminin α5 chain.

We also used sol-Lu to further characterize the nature of the interaction between Lu and

laminin α5. Divalent cations are required for the binding of other laminin receptors such as

integrins and dystroglycan (37,38) and the binding of dystroglycan is affected by

glycosminoglycans (18,37). In contrast, the binding of sol-Lu to laminin α5 was not inhibited by

EDTA or by heparin (Fig. 1C). However, high salt did inhibit the interaction (Fig. 1C), as is

typical for biologically relevant protein-protein interactions.

Binding specificity of sol-Lu

There is a possibility that Lu also binds to other laminins or to unknown ligands. To test

the specificity of Lu binding, we performed histochemistry using sol-Lu as a probe on tissue

sections. Bound sol-Lu was detected by monoclonal antibody against human Lu. Sol-Lu bound

to basement membranes containing the laminin α5 chain in tissue sections of an embryonic day

(E) 13.5 mouse embryo (Fig.2A, C). The pattern of sol-Lu binding was identical to the

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

expression of laminin α5 chain in tissues such as lung, intestine, kidney and pharynx (data not

shown). There was no binding of sol-Lu to tissue sections from Lama5 -/- embryos (Fig. 2B, D).

However, laminins α1, α2, α3 and α4 were detected in Lama5 -/- basement membranes (Fig.2E,

F, G, H). Together, these results suggest that Lu is a specific receptor for the laminin α5 chain

and does not bind to other α chains or to other basement membrane components.

Binding of sol-Lu to the laminin 5 chain G domain: in vitro assays

Although the laminin binding site on Lu has been mapped to the first three of the five

extracellular Ig domains, the structural basis for laminin α5 binding to Lu is unknown. To

approach identification of the Lu binding site, we prepared a chimeric construct encoding

laminin α5 domains VI through I/II linked to the human laminin α1 G domain, designated Mr51

(Fig. 3). The construct encoding full-length laminin α5, Mr5, was also prepared as a positive

control. To force expression of these transgenes in a variety of cell types, we used the miw

expression vector, which directs widespread expression in transgenic mice (39) (and our own

unpublished data). The constructs were microinjected to generate transgenic mice. We obtained

two independent lines of mice that expressed the full-length laminin α5 protein. Transgene-

derived protein presumably trimerizes with β and γ chains and assembles into basement

membranes. During embryogenesis, transgene-derived laminin α5 levels were significantly

increased in heart and skeletal muscle (28). Five founder mice harboring the Mr51 transgene

were also generated. Transgene-positive offspring of the five founders were tested for

expression using the anti-human laminin α1G domain monoclonal antibody, as well as our

polyclonal antiserum to mouse laminin α5, domains IIIb and IVa. E13.5 embryos from all five

lines expressed Mr51 protein in a similar fashion: high levels of chimeric protein were present in

heart, and moderate levels were present in lung, kidney, skeletal muscle, airway epithelial, and

brain pial basement membranes (Kikkawa and Miner, in preparation). Since the expression of

endogenous laminin α5 is very low in embryonic heart (Fig. 4A), and Mr5 and Mr51 were

strongly expressed in embryonic heart (Fig. 4C, E), we chose heart for sol-Lu binding assays.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

11

Sol-Lu bound to heart expressing Mr5 (Fig. 4D) but not to the control heart or to heart

expressing Mr51 (Fig. 4B, F). This indicates that the G domain of laminin α5 is required for sol-

Lu binding, and we conclude that the G domain contains the Lu binding site.

Binding of Lu to the laminin 5 chain G domain: in vivo assay

Next transgenic mice expressing Mr5 or Mr51 on the Lama5 -/- genetic background were

generated. Mouse genotypes were determined by PCR using appropriate primers. Mr5 was able

to rescue all Lama5 -/- embryonic defects, but Mr51 could not (Kikkawa and Miner, in

preparation). Mr5- and Mr51-derived proteins assembled into basement membranes (Fig. 5 A,

B). As before, Mr51 was detected with a monoclonal antibody against human α1LG4-5,

163DE4 (Fig. 5D) which did not cross-react with Mr5 (Fig. 5C). An antibody against the

intracellular domain of Lu demonstrated that Lu was concentrated on epithelial cells in Lama5 -/-

; Mr5 tissue (Fig. 5E), just as it is in wild-type (28). On the other hand, Lu was diffuse in Lama5

-/-; Mr51 tissue (Fig. 5F). These results show that Lu interacts with the laminin α5 G domain in

vivo, because the G domain of α5, but not the G domain of α1, was able to polarize Lu.

Lack of sol-Lu binding to endogenous laminin 5 expressed in embryonic skeletal muscle

The basement membrane of embryonic skeletal muscle, both extrasynaptic and synaptic,

is rich in the laminin α5 chain (40). Here, we found that an antibody against laminin α5 LG4-5

stained the basement membranes of most E17.5 embryonic tissues, but did not stain skeletal

muscle (Fig. 6A, B, C, D, and data not shown). This suggested that the COOH-terminus of

endogenous laminin α5 is either cleaved by protease or masked in embryonic skeletal muscle.

The sol-Lu binding assay was performed on sections containing E17.5 embryonic lung and

skeletal muscle. The sol-Lu bound to laminin α5 expressed in lung but not in skeletal muscle

(Fig. 6E, F). These results suggest that the Lu binding site of laminin α5 is cleaved by protease

in skeletal muscle, and that the binding site may be present in LG4-5. However, the lack of

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

12

reactivity with the anti-LG4-5 antiserum does not reveal where the putative cleavage event

occurs, only that it is NH2-terminal to the most distal epitope recognized by the antiserum.

Binding of sol-Lu to 5LG modules

To attempt to more definitively narrow the binding site of Lu in laminin α5, we prepared

two new chimeric laminin cDNAs encoding laminin α5 domains VI through either LG2 or LG3,

linked to the human laminin α1 LG3-5 and LG4-5 domains, respectively. These were cloned

into the miw expression vector and designated Mr5G2 and Mr5G3 (Fig. 7). The constructs were

microinjected to produce transgenic mice. We obtained one founder for each construct that

expressed the transgene. Tissues taken from one to 2 week old mice were analysed. The

antibody against laminin α5 domain IIIb/IVa stained the basement membranes of skeletal muscle

in all cases (Fig. 8A, E, I). As described above, the endogenous laminin α5 chain in skeletal

muscle lacked immunoreactivity with anti-α5LG4-5, as did the transgene-derived proteins (Fig

8B, F, J). However, Mr5G2 and Mr5G3 could be detected with the monoclonal antibody against

α1LG4-5, 163DE4 (Fig. 8G, K), indicating that the chimeric proteins are expressed and

incorporate into basement membranes. Sol-Lu bound to Mr5G3 (Fig. 8L) but not to Mr5G2

(Fig. 8H). This demonstrates that α5LG3 is crucial for Lu binding.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

13

DISCUSSION

Lu is a member of the immunoglobulin superfamily and has five extracellular Ig-like

domains, a transmembrane domain, and a cytoplasmic COOH-terminal domain of 40 amino

acids (23). The cytoplasmic tail is absent in the human Lu isoform, B-CAM (21). In previous in

vitro studies, the interaction between Lu and laminin-10/11 containing the α5 chain has been

well demonstrated (19,20,25,27,41). The extracellular domain of Lu contains N-glycosylation

consensus motifs. Recently it was reported that Ig-like domains 1-3 are involved in binding to

laminin α5 (27,29), but the N-glycosylation motifs were not found to be involved in laminin

binding. A bacterial Lu recombinant protein that we initially prepared did not bind to laminin-

10/11 (data not shown), suggesting that proper glycosylation is required to ensure proper folding.

We also produced a recombinant human Lu extracellular domain (sol-Lu) in mammalian

cells. Sol-Lu migrated at a higher molecular weight than predicted from the deduced amino acid

sequence, suggesting that it was glycosylated. It reacted with a monoclonal antibody against

human Lu and bound to laminin-10/11 but not to laminin-1 (Fig. 1). We therefore concluded

that sol-Lu has binding properties similar to native cell surface Lu and is an appropriate tool to

investigate the Lu binding site on laminin α5. It is interesting that the binding of sol-Lu to

laminin-10/11 was not inhibited by EDTA and heparin. Divalent cations are required for the

binding of other laminin receptors such as integrins and dystroglycan (37,38). The binding of

dystroglycan is also affected by glycosminoglycans (18,37). Lu therefore has laminin-binding

properties significantly different from integrins and dystroglycan.

Our previous study demonstrated that Lu is localized on the basal surface of many

epithelial cells and on the surface of a subset of muscle cells, in all cases adjacent to basement

membranes containing laminin α5 (28). The localization of Lu suggested that Lu interacts with

the laminin α5 chain in vivo. In the present study we examined whether there are other ligands

for Lu. Soluble receptor binding assays on tissues is a proven method to reveal the presence of

unknown ligands (42). Sol-Lu made it possible for us to perform binding assays on tissue

sections. When applied to wild type tissue sections, sol-Lu bound to basement membranes

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

14

containing laminin α5. The binding of sol-Lu totally disappeared from laminin α5 knockout

tissues, further demonstrating its specificity. The five laminin α chains share similarities in

sequence and domain structure (8,10). Although laminin α1−4 chains were detected in basement

membranes in Lama5 -/- tissue, sol-Lu did not bind to them. This suggests that only laminin α5

bears the specific sequence or structure for Lu binding. Thus, while integrin α3β1, α6β1, α6β4,

and dystroglycan are promiscuous laminin receptors (2), Lu is a specific receptor for laminin α5,

at least during embryogenesis. Conditional laminin α5 knockout mice being generated in our

laboratory will allow us to search for novel Lu ligands in adult tissues.

Until now, there has been no data addressing the structural basis of laminin α5 binding to

Lu. We generated transgenic mice expressing chimeric laminin α5/α1 chains that incorporated

into basement membranes. This allowed us to search for the Lu binding site in the context of a

bona fide basement membrane. The α5LG3 module was identified as being required for Lu

binding, and we suggest that it contains the binding site. However it is possible that Lu binding

requires not only α5LG3 but also α5LG1-2. LG modules are also important ligands for other

cellular receptors, such as integrins and dystroglycan (9). Together with these and other laminin

receptors, Lu could regulate growth, adhesion, and differentiation of epithelial cells.

Interestingly, we found that the endogenous laminin α5 chain expressed in embryonic

skeletal muscle lacks reactivity with an α5LG4-5 antiserum and does not bind sol-Lu. The

straightforward interpretation is that Lu binds to α5LG4-5. However, since sol-Lu binds to

Mr5G3, which lacks α5LG4-5 but contains α1LG4-5 instead, the Lu binding site must be in

α5LG1-3. In skeletal muscle, it is possible that α5LG4-5 is released by protease, and this

somehow affects the binding affinity of Lu for α5LG1-3. It has been shown that the G domains

of laminin α 2, α 3, and α 4 chains are cleaved by proteolytic processing (9,32,43). The link

region between α5LG3 and LG4 modules contains an RRXR sequence, which is a furin-type

cleavage site (8,10). This site is also conserved in the link region of human laminin α5 (44).

Proteolytic processing appears to have occurred in this link region in skeletal muscle and perhaps

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

15

affected Lu binding. Alternatively, protease cleavage sites may lie further upstream, resulting in

removal of the critical LG3 module.

Adhesion of sickled red blood cells to laminin α5 via Lu is suspected to contribute to the

painful vaso-occlusion episodes that occur in sickle cell patients (25,26). In addition, Lu/B-

CAM overexpressed in some epithelial cancers may promote tumor metastasis (21,22). In the

future, it is important to define at the amino acid level the critical structural determinants of

laminin α5 and Lu that mediate their binding to each other. Towards this end, novel chimeric

laminins are being generated in our laboratory. With additional details about the Lu binding site,

it may be possible to develop inhibitors that block the binding of Lu to laminin α5 in vivo. Such

inhibitors may suppress vaso-occlusion in sickle cell disease and tumor cell metastasis in cancer.

ACKNOWLEDGMENTS

This work was supported by grants P50 DK045181 (George M. O’Brien Kidney

Research Center) and R01 GM060432 from the National Institutes of Health and by Research

Grants #6-FY99-232 and #1-FY02-192 from the March of Dimes to J. H. M.

We thank Cong Li and Gloriosa Go for technical assistance; the Mouse Genetics Core at

Washington University School of Medicine for generating and caring for transgenic mice;

Jacqueline L. Mudd for producing the Mr5 transgenic mice; Karl Tryggvason for supplying the

human laminin α1 cDNA; and Peter Yurchenco, Peter Marinkovich, Rupert Timpl, and Takako

Sasaki for generously providing antibodies.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

16

REFERENCES1. Aumailley, M., and Smyth, N. (1998) J. Anat. 193, 1-212. Colognato, H., and Yurchenco, P. D. (2000) Dev. Dyn. 218, 213-2343. Burgeson, R. E., Chiquet, M., Deutzmann, R., Ekblom, P., Engel, J., Kleinman, H.,

Martin, G. R., Meneguzzi, G., Paulsson, M., Sanes, J., Timpl, R., Tryggvason, K.,Yamada, Y., and Yurchenco, P. D. (1994) Matrix Biol. 14, 209-211

4. Miner, J. H., Patton, B. L., Lentz, S. I., Gilbert, D. J., Snider, W. D., Jenkins, N. A.,Copeland, N. G., and Sanes, J. R. (1997) J. Cell Biol. 137, 685-701

5. Koch, M., Olson, P. F., Albus, A., Jin, W., Hunter, D. D., Brunken, W. J., Burgeson, R.E., and Champliaud, M. F. (1999) J. Cell Biol. 145, 605-618

6. Libby, R. T., Champliaud, M. F., Claudepierre, T., Xu, Y., Gibbons, E. P., Koch, M.,Burgeson, R. E., Hunter, D. D., and Brunken, W. J. (2000) J. Neurosci. 20, 6517-6528

7. Champliaud, M. F., Virtanen, I., Tiger, C. F., Korhonen, M., Burgeson, R., and Gullberg,D. (2000) Exp. Cell Res. 259, 326-335

8. Timpl, R., Tisi, D., Talts, J. F., Andac, Z., Sasaki, T., and Hohenester, E. (2000) MatrixBiol. 19, 309-317

9. Talts, J. F., and Timpl, R. (1999) FEBS Lett. 458, 319-32310. Miner, J. H., Lewis, R. M., and Sanes, J. R. (1995) J. Biol. Chem. 270, 28523-2852611. Sorokin, L. M., Pausch, F., Durbeej, M., and Ekblom, P. (1997) Dev. Dyn. 210, 446-46212. Sorokin, L. M., Pausch, F., Frieser, M., Kroger, S., Ohage, E., and Deutzmann, R. (1997)

Dev. Biol. 189, 285-30013. Miner, J. H., Cunningham, J., and Sanes, J. R. (1998) J. Cell Biol. 143, 1713-172314. Nguyen, N. M., Miner, J. H., Pierce, R. A., and Senior, R. M. (2002) Dev. Biol. 246, 231-

24415. Miner, J. H., and Li, C. (2000) Dev. Biol. 217, 278-28916. Kikkawa, Y., Sanzen, N., and Sekiguchi, K. (1998) J. Biol. Chem. 273, 15854-1585917. Kikkawa, Y., Sanzen, N., Fujiwara, H., Sonnenberg, A., and Sekiguchi, K. (2000) J. Cell

Sci. 113, 869-87618. Shimizu, H., Hosokawa, H., Ninomiya, H., Miner, J. H., and Masaki, T. (1999) J. Biol.

Chem. 274, 11995-1200019. El Nemer, W., Gane, P., Colin, Y., Bony, V., Rahuel, C., Galacteros, F., Cartron, J. P.,

and Le Van Kim, C. (1998) J. Biol. Chem. 273, 16686-16693.20. Zen, Q., Cottman, M., Truskey, G., Fraser, R., and J., T. M. (1999) J. Biol. Chem. 274,

728-73421. Campbell, I. G., Foulkes, W. D., Senger, G., Trowadale, J., Garin-Chesa, P., and Retting,

W. J. (1994) Cancer Res. 54, 5761-576522. Garin-Chesa, P., Sanz-Moncasi, M.-P., Campbell, I. G., and Rettig, W. J. (1994) Int. J.

Oncol. 5, 1261-126623. Rahuel, C., Le Van Kim, C., Mattei, M. G., Cartron, J. P., and Colin, Y. (1996) Blood 88,

1865-187224. El Nemer, W., Rahuel, C., Colin, Y., Gane, P., Cartron, J. P., and Le Vam Kim, C. (1997)

Blood 89, 4608-461625. Udai, M., Zen, Q., Cottman, M., Leonard, N., Jefferson, S., Daymont, C., Truskey, G.,

and Telen, M. J. (1998) J. Clin. Invest. 101, 2550-255826. Lee, S. P., Cunningham, M. L., Hines, P. C., Joneckies, C. C., Orringer, E. P., and Parise,

L. V. (1998) Blood 92, 2951-2958

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17

27. Parsons, S. F., Lee, G., Spring, F. A., Willig, T. N., Peters, L. L., Gimm, J. A., Tanner,M. J., Mohandas, N., Anstee, D. J., and Chasis, J. A. (2001) Blood 97, 312-320

28. Moulson, C. L., Li, C., and Miner, J. H. (2001) Dev. Dyn. 222, 101-11429. El Nemer, W., Gane, P., Colin, Y., M., D. A. A., Callebaut, I., Carton, J.-P., and Le Van

Kim, C. (2001) J. Biol. Chem. 276, 23757-2376230. Virtanen, I., Gullberg, D., Rissanen, J., Kivilaakso, E., Kiviluoto, T., Laitinen, L. A.,

Lehto, V. P., and Ekblom, P. (2000) Exp. Cell Res. 257, 298-30931. Cheng, Y.-S., Champliaud, M.-F., Burgeson, R. E., Marinkovich, M. P., and Yurchenco,

P. D. (1997) J. Biol. Chem. 272, 31525-3153232. Marinkovich, M. P., Lunstrum, G. P., Keene, D. R., and Burgeson, R. E. (1992) J. Cell

Biol. 119, 695-70333. Ettner, N., Gohring, W., Sasaki, T., Mann, K., and Timpl, R. (1998) FEBS Lett. 430, 217-

22134. Sasaki, T., Mann, K., and Timpl, R. (2001) FEBS Lett. 505, 173-17835. Talts, J. F., Mann, K., Yamada, Y., and Timpl, R. (1998) FEBS Lett. 426, 71-7636. Elion, E. A. (1998) in Current Protocols in Molecular Biology (Ausubel, F. M., Brent,

R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., eds), pp.3.17.17, John Wiley & Sons, Inc.

37. Ervasti, J. M., and Campbell, K. P. (1993) J. Cell Biol. 122, 809-82338. Humphries, M. J. (2000) Biochem. Soc. Trans. 28, 311-33939. Suemori, H., Kadokawa, Y., Goto, K., Araki, I., Kondoh, H., and Nakatsuji, N. (1990)

Cell Differ. Dev. 29, 181-18640. Patton, B. L., Miner, J. H., Chiu, A. Y., and Sanes, J. R. (1997) J. Cell Biol. 139, 1507-

152141. Rahuel, C., Colin, Y., Goossens, D., Gane, P., El Nemer, W., Carton, J. P., and Le Van

Kim, C. (1999) Immuogenetics 50, 271-27742. Muller, U., Wang, D., Denda, S., Meneses, J. J., Pedersen, R. A., and Reichardt, L. F.

(1997) Cell 88, 603-61343. Tsubota, Y., Mizushima, H., Hirosaki, T., Higashi, S., Yasumitsu, H., and Miyazaki, K.

(2000) Biochem. Biophys. Res. Commun. 278, 614-62044. Durkin, M. E., Loechel, F., Mattei, M. G., Gilpin, B. J., Albrechtsen, R., and Wewer, U.

M. (1997) FEBS Lett. 411, 296-300

FOOTNOTES

1 The abbreviations used are : G, globular; LG, laminin-type globular; Lu, Lutheran blood group

glycoprotein; B-CAM, basal cell adhesion molecule; PCR, polymerase chain reaction; Sol-Lu,

soluble Lu; E, embryonic day; PBS(-), Ca2+ and Mg2+ -free phosphate-buffered saline.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

18

FIGURE LEGENDS

Fig. 1. Solid-phase binding assays of soluble Lu to laminin-1 and laminin-10/11. (A) Sol-Lu

purified from conditioned medium of COS-7 transfectants was subjected to SDS-PAGE on a

7.5% gel under non-reducing conditions. Protein was stained with Coomassie Brilliant Blue. Mr

standards are indicated. (B) Dose-response binding of sol-Lu to laminins. 96-well microtiter

plates were coated with increasing concentrations of mouse laminin-1 (open squares) or human

laminin-10/11 (open circles) and incubated with sol-Lu at 37°C for 1h. Similar results were

obtained in three independent experiments. (C) Effects of EDTA, heparin, and high salt on

binding of sol-Lu to laminin-10/11. Wells of microtiter plates were coated with 20 µg/ml of

laminin-10/11. EDTA, heparin, and high salt (NaCl) were mixed with soluble Lu at 5 mM, 100

µg/ml, and 1 M, respectively. Each column represents the mean of triplicate assays. Bars,

standard deviation.

Fig. 2. Lu binds specifically to laminin 5. Sections containing the surface ectodermal

basement membrane of E13.5 Lama5 +/- (control) and Lama5 -/- embryos were stained with

antiserum against laminin α5 (A, B) and with sol-Lu (C, D). (E-H) Expression of other laminin

α chains in the Lama5 -/- mutant. Cryosections were stained with antisera recognizing the four

other laminin α chains, as indicated. Laminin α1-4 chains were expressed and localized to

basement membranes, but sol-Lu did not bind to them (D). Bar, 100 µm.

Fig. 3. Diagram of the cDNA constructs used to generate transgenic mice. Mr5: full-length

mouse laminin α5 chain. Mr51: The chimeric construct encoding laminin α5 domains VI

through I/II linked to the human laminin α1 G domain (shaded). Both constructs were cloned

into the modified miw expression vector and used to produce transgenic mice.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

19

Fig. 4. Binding of soluble Lu to heart sections. Micrographs show sections of E13.5 heart

from embryos carrying either no transgene (A and B), the Mr5 transgene (C and D), or the Mr51

transgene (E and F). Tissue sections were incubated with sol-Lu at room temperature for 1h.

Transgene products and bound sol-Lu were detected with an antiserum against laminin α5

domain IIIb/IVa (A, C and E) and a monoclonal antibody against human Lu (B, D and F),

respectively.

Fig. 5. Binding of endogenous Lu to the laminin 5 G domain in vivo. Micrographs show

E13.5 surface ectoderm in sections of a Lama5 -/- embryo with either the Mr5 (A, C and E) or

Mr51 (B, D and F) transgenes. Sections were stained with an antiserum against laminin α5 (A

and B), a monoclonal antibody human laminin α1 LG4-5 (C and D), or an antiserum specific for

Lu (E and F). Lu was only basally concentrated when the α5 G domain was present (E). Bar,

100 µm.

Fig. 6. Sol-Lu does not bind laminin 5 expressed in embryonic skeletal muscle.

Micrographs show wild-type E17.5 lung (A, C, and E) and skeletal muscle (B, D, and F).

Sections were stained with antiserum against laminin α5 domain IIIB/IVa (A and B) or LG4-5

(C and D). The laminin α5 chain expressed in embryonic skeletal muscle was not reactive with

antiserum to α5LG4-5 (D). (E and F) When sol-Lu was applied to sections, it bound to lung (E)

but not to skeletal muscle (F). These results suggest that laminin α5 in embryonic skeletal

muscle lacks α5LG4-5 and the Lu binding site. Bar, 100 µm.

Fig. 7. Diagram of the chimeric cDNAs designed to narrow the Lu binding site. Mr5G2 and

Mr5G3 are chimeric constructs encoding laminin α5 domains VI through LG2 and LG3 linked to

the human laminin α1LG3-5 and LG4-5, respectively. Mr51 and Mr5 are described in Fig. 3.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

20

Fig. 8. Identification of the Lu binding site in laminin 5. Micrographs show skeletal muscle

from wild type (A-D), Mr5G2 (E-H), and Mr5G3 (I-L) pups. Sections were stained with:

antiserum against laminin α5 domain IIIb/IVa (A, E, and I); antiserum against α5LG4-5 domain

(B, F, and J); antibody against human laminin α1 LG4-5 (C, G, and K); and sol-Lu (D, H, and

L). Sol-Lu bound to Mr5G3 (L) but not to Mr5G2 (H), indicating that α5LG3 is critical for Lu

binding. The endogenous laminin α5 chain in postnatal muscle lacked reactivity with the

antiserum against α5LG4-5 (B) and lacked sol-Lu binding activity (C), similar to embryonic

skeletal muscle (Fig. 6). Bar, 50 µm.

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

0

0.1

0.2

0.3

0.4

1 10 100

Fig. 1 (A)

220

40

60

7090

130

kDa

A49

2Protein concentration (mg/ml)

(B)

(C)

00.10.20.30.40.50.6

A49

2

control EDTA heparin high salt

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

A B

C D

E F

G H

Fig. 2

α1 α2

α3 α4

+/- -/-

+/- -/-

-/- -/-

-/- -/-

α5 α5

Sol-Lu Sol-Lu

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

laminin α chain

α5

α1α5

full length α5

chimera α5/α1

}G domain

α5

Fig. 3

Mr5

Mr51

VI V IVb IVa

IIIb IIIa

I/II

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Fig. 4

A B

C D

E F

Con

trol

Mr5

Mr5

1

α5IIIb-IVa Sol-Lu

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

A B

C D

E F

Fig. 5

Lama5-/-Mr5

α5II

Ib-I

Va

hα1L

G4-

5L

u

Lama5-/-Mr51

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Fig. 6

A B

C D

E F

lung skeletal muscle

α5II

Ib-I

Va

α5L

G4-

5So

l-L

u

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

α5 1 2 3 4 5Mr5

α1α5 1 2Mr5G2

α5 1 2 3Mr5G3 α1

α1α5Mr51

laminin α chain }G domain

Fig. 7

12 3

45

VI V IVb IVa

IIIb IIIa

I/II

LG module

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

A B

E F

I J

C D

G H

K L

Fig. 8

α5IIIb-IVa α5LG4-5 Sol-Luhα1LG4-5

Con

trol

Mr5

G2

Mr5

G3

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Yamato Kikkawa, Casey L. Moulson, Ismo Virtanen and Jeffrey H. Miner5 through expression of chimeric laminin chains in vivoα

Identification of the binding site for the Lutheran blood group glycoprotein on laminin

published online September 18, 2002J. Biol. Chem. 

  10.1074/jbc.M208731200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on April 12, 2018

http://ww

w.jbc.org/

Dow

nloaded from