1 Genes and Expression 51:123 Terry Braun 2 Today's Outline Gene structure genomic structure vs mRNA structure ESTs coding and noncoding exons introns primary transcript processing memory pneumonic alternative splicing and differential polyadenylation 3 Genome (3 Bb) zoom inAdenine Thymine Guanine Cytosine ATGC purines AG pyrimidines CT 4 Central Dogma gene portions of a genome that affect the transcription, translation, and expression of functionally active molecules (proteins, DNA [promoters] rRNA, mRNA, tRNA, etc) gene often used to describe the coding regions of genomes the portions of DNA that are made into a protein (via transcription, and translation) DNA -> pre-mRNA -> mRNA -> protein 5 Central Dogma DNA -> pre-mRNA -> mRNA -> protein DNA is transcribed into pre-mRNA introns are removed lariat structure exons remain (spliced together), also called the coding regions called mRNA splice site junctions mRNA is translated into protein 6 Schellenberg MJ, Ritchie DB, MacMillan AM. Pre-mRNA splicing: a complex picture in higher definition. Trends Biochem Sci Jun;33(6): Epub 2008 May 9. Review. 7 Gene Structure: gene to protein 8 Example of Gene in Genomic Context Context of gene BBS4 in the human genome. Scale = Kb Exons and introns Note possible upstream gene, on other strand Less than 3% of the genome is transcribed and translated into a protein. Human Genome Project Problem How do you find all of the genes in a sea of DNA? 9 Wheres the gene? >BBS4 exon2 TAAAGTAACTCTATCACAATATGGATTTAATGGATTAATTGCATAATTGGTGAGCTACT G ATTATTCTTGTTATTTGGATGCTTCTTTAAGTTAGCAAGTTTATATTGTGGTGCTTCAA T ATAGACTACTTATTTCATTTCAGAGAACTCAATTTCCTGTATCTACTGAGTCTCAAAAA C CCCGGCAGAAAAAAGGTCTGTATGCAGTTTCATGGTATGTGTATGTTTGCACAGACA GAT TTCTCTTTTATTTATTTATTTATTTTTTTTTTTGGAGGCAGAGTCTCACTGTCACCCAG G CTGGAGTGCAGTAGCACAATCTTGGCTCACTGCAACCTTTGCCTCTGGGGCTCAAG CAAT TCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGTGCACGCCACCACACCTG GCTA 10 Wheres the gene? >BBS4 exon2 TAAAGTAACTCTATCACAATATGGATTTAATGGATTAATTGCATAATTGGTGAGCTACT G ATTATTCTTGTTATTTGGATGCTTCTTTAAGTTAGCAAGTTTATATTGTGGTGCTTCAA T ATAGACTACTTATTTCATTTCAGAGAACTCAATTTCCTGTATCTACTGAGTCTCAAAAA C CCCGGCAGAAAAAAGGTCTGTATGCAGTTTCATGGTATGTGTATGTTTGCACAGACA GAT TTCTCTTTTATTTATTTATTTATTTTTTTTTTTGGAGGCAGAGTCTCACTGTCACCCAG G CTGGAGTGCAGTAGCACAATCTTGGCTCACTGCAACCTTTGCCTCTGGGGCTCAAG CAAT TCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGTGCACGCCACCACACCTG GCTA 11 12 ESTs Expressed Sequence Tags If we could read the sequence at only the front (5') or end(3') of mRNAs (transcripts), or even in the middle, that would be conclusive evidence of a gene Uniquely (?) identify all of the genes Do not have full expense of sequencing the whole gene sequence (100's of nucleotides VS 1000's) Can observe differences of expression in tissues Many questioned whether the complete genome should even be sequenced 13 ESTs at Iowa Approach Harvest mRNAs and sequence them Subtract out what you have already seen (serial subtraction) Rat gene discovery at Iowa (2003) 233,890 3-prime ESTs, 50,075 5-prime ESTs 57,822 clusters (8/26/2003) novelty = 57,822/(233, ,075) = 0.20 14 15 C-Value Paradox Hartl, Molecular melodies in high and low C, Nat. Rev. Genetics, Nov 2001 refers to the massive, counterintuitive and seemingly arbitrary differences in genome size observed in eukaryotic organisms Drosophila melanogaster 180 Mb Podisma pedestris 18,000 Mb difference is difficult to explain in view of apparently similar levels of evolutionary, developmental, and behavioral complexity more to a genome than coding sequences example Alu repeats ~ 250 nucleotides humans, chimps, gorillas Not in rat/mouse 16 Repetitive Elements LINEs20.4%868,000 SINEs13.41,558,000 alus10.61,090,000 transposons2.8294,000 Sudbery 2002 Human Mol Genetics number elements 17 Alternative Splicing Every conceivable pattern of alternative splicing is found in nature. Exons have multiple 5 or 3 splice sites alternatively used (a, b). Single cassette exons can reside between 2 constitutive exons such that alternative exon is either included or skipped ( c ). Multiple cassette exons can reside between 2 constitutive exons such that the splicing machinery must choose between them (d). Finally, introns can be retained in the mRNA and become translated. Graveley, Alternative splicing: increasing diversity in the proteomic world. Trends in Genetics, Feb., 2001. 18 Each amino acid contains an "amine" group (NH3) and a "carboxy" group (COOH) (shown in black in the diagram). The amino acids vary in their side chains (indicated in blue in the diagram). The eight amino acids in the orange area are nonpolar/ hydrophobic. The other amino acids are polar/ hydrophilic ("water loving"). The two amino acids in the purple box are acidic ("carboxy" group in the side chain). The three amino acids in the blue box are basic ("amine" group in the side chain). Know relationship between DNA, mRNA, and aas Relevance to disease: changes L to I? Cysteine and disulfide bonds nonpolar: internal, polar: external (interacts with H20) 19 A ala alanineM met methionine C cys cysteineN asn aspargine D asp aspartic acidP pro proline E glu glutamic acidQ gln glutamine F phe phenylalanineR arg arginine G gly glycineS ser serine H his histidineT thr threonine I ile isoleucineV val valine K lys lysineW trp tryptophane L leu leucineY tyr tyrosine 20 Review Codon Table One codon: Met, Trp. Two codons: Asn, Asp, Cys, Gln, Glu, His, Lys, Phe, Tyr, Three codons: Ile, STOP ("nonsense"). Four codons: Ala, Gly, Pro, Thr, Val. Five codons: none. Six codons: Arg, Leu, Ser. degenerate code gene prediction 21 Mutations Mis-sense Non-sense 22 From Slide 6 ATG CCC TTC TCC AAC AGC GT -- splice donor M P F S N S CCT GCC CCC CAT GCC TGA P A P H A STOP Delete CC ATG CCC TTC TAA CAG CCC M P F Stop Q P TGC CCC CCA TGC CTG AGG GGC C P P C L R G ? 23 Codon Bias PAM1 (Point Accepted Mutations) Dayhoff 1978 global alignment of closely related proteins (85% identical) = 62 # Entropy = , Expected = A R N D C Q E G H I L K M F P S T W Y V B Z X * A R N D C Q E G H I L K M F P S T W Y V B Z X * 25 Expression A gene is expressed when the DNA sequence in the genome is transcribed into an mRNA molecule, and that mRNA molecule is correctly made into a protein (aka. string of amino acids for polypeptide). Note that evaluation of expression is often done by examining/counting the amount/number of mRNA molecules made by the cells of a particular tissue. 26 DNA/RNA/Protein and Strands promoters anywhere from 1 to 10 KB to ??? upstream of a gene many proteins and other molecules (RNAs) involved largely unknown promoter bashing replace or delete regions of DNA in promoter measure level of expression trans- and cis- regulatory elements trans not co-localized to the gene cis generally localized to the gene 27 Example -- LCR An example of the functional potential for non-coding regions is the locus control region of the opsin gene cluster (Nathans, et. al. 1989) shown to cause 50% of the cases of blue cone monochromacy. The locus control region is approximately 4 kilobases upstream of the red opsin gene, and 43 kilobases upstream of the green opsin gene. The 579 base region was mapped to the X-chromosome using observed deletions upstream of the red-green opsin gene cluster in individuals with blue cone monochromacy. Blue cone monochromatism is characterized by poor central vision and color discrimination and nearly normal retinal appearance. 28 DNA/RNA/protein figure 29 End 30 Microarray Technology No genomics discussion would be complete without describing microarray technology. A powerful tool for genetic research which utilizes nucleic acid hybridization techniques and recent advancements in computing technology to evaluate the mRNA expression profile of thousands of gene in one single experiment. It has proven to be an extremely valuable method to better utilize the enormous amount of information provided by the completion of the human Genome Project. 31 Gene Expression: Motivation Pattern of gene expression in a cell is characteristic of its current state Virtually all differences in cell state or type can be correlated with differences in mRNA expression levels Expression patterns can provide clues to gene function and metabolic pathway architecture 32 Potential Impact Preventative medicine Subtype diseases in order to design better drugs for a specific genotype More targeted drug treatment -- treat disease rather than symptoms 33 Steps involved in Designing Microarray Experiment Preparation of fluorescently labeled target from RNA isolated from the biological sample (aka biological sample). Hybridization of the labeled target to the microarray. Washing, staining, and scanning of the array. Analysis of the scanned image. Generation of gene expression profiles. 34 Physical Spotting 35 DNA Array Technology Cell Lines cDNA libraries and/or gene sequence data TargetProbe Hybridization RNA Data Acquisition Expression Levels Analysis Surface 36 Probe Example 37 38 Microarrays: What are they? 39 Microarray Experiment 326 Rat Heart Genes, 2x spotting 40 Affymetrix Technology 41 Affymetrix Chip 42 Hybridization/Microarray Tech. Very large scale multiples of 1K density for glass slides cheap custom considered not as reliable Affy U133 2 chips 45,000 probe sets 39,000 transcripts 33,000 genes SNP chip 11,500 SNPs (single nucleotide polymorphisms, or genotypes) 100,000 SNPs (another year?) Research and funding dilemma NIH sponsored funding only distilled data (if that) made available confidentiality issues 43 Examples of Analysis simple filter all up, all down clustering Eisen diagrams volcano plots Mootha approach 44 End Expression 45 Polyadenylation (Poly-A) The addition of multiple adenines to a pre- mRNA and is part of the end of the transcription process Three steps 1) the RNA strand is cleaved at a particular site 2) the addition of poly-A's to the 3' end 3) the degradation of the remainder of the RNA transcript 46 Polyadenylation Cut degraded polyadenylated AAA n 47 Poly-A Signal AAUAAA specifies where the mRNA is cleaved, and the Poly-A is added Typically 23 or 24 bases downstream of this signal A's added Increases translatability by about 20-fold (mechanism unknown). Also thought to improve stability protecting the end of the mRNA molecule from exonucleases. 48 Alternative Polyadenylation common in human RNA (Edwards-Gilbert 1997) in many genes, 2 or more poly-A signals in 3 UTR alternative transcripts can show tissue specificity alternative poly-A signals may be brought into play following alternative splicing 49 Edwards-Gilbert. Nucleic Acids Res, 13, 1997 50 End