1 characterization of microevolution events in...
TRANSCRIPT
![Page 1: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/1.jpg)
1
Characterization of microevolution events in Mycobacterium tuberculosis strains 1
involved in recent transmission clusters 2
3
4
5
6
7
Laura Pérez-Lago1,2
, Marta Herranz1,2,3
, Miguel Martínez Lirola3, †
, Emilio 8
Bouza1,2,3
, Darío García de Viedma1,2,3
9
10
11
12
13
1Servicio de Microbiología y Enfermedades Infecciosas, Hospital Gregorio Marañón, Madrid, 14
Spain 15
2Instituto de Investigación Biomédica Gregorio Marañón, Madrid, Spain 16
17 3CIBER Enfermedades Respiratorias-CIBERES, Spain 18
4Complejo Hospitalario Torrecárdenas, Almería, Spain.
†On behalf of the INDAL-TB 19
group 20
21
22
23
24
*Corresponding author: 25
Servicio de Microbiología y Enfermedades Infecciosas 26
Hospital General Universitario Gregorio Marañón 27
C/ Dr Esquerdo, 46 28
28007 Madrid, Spain 29
Fax: 91 5044906 30
Email: [email protected] 31
32
33
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.01285-11 JCM Accepts, published online ahead of print on 21 September 2011
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 2: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/2.jpg)
2
Summary 34
35
In certain circumstances, it is possible to identify clonal variants of 36
Mycobacterium tuberculosis (MTB) infecting a single patient, probably as a result of 37
subtle genetic rearrangements in part of the bacillary population. We systematically 38
searched for these microevolution events in a different context, namely, recent 39
transmission chains. We studied the clustered cases identified using a population-based 40
universal molecular epidemiology strategy over a 5-year period. Clonal variants of the 41
reference strain defining the cluster were found in 9 (12%) out of the 74 clusters 42
identified after genotyping 612 MTB isolates by IS6110 RFLP and MIRU-VNTR. 43
Clusters with microevolution events were epidemiologically supported and involved 4-9 44
cases diagnosed over a 1 to 5–year period. The IS6110 insertion sites from 16 45
representative isolates of reference and microevolved variants were mapped by ligation-46
mediated PCR in order to characterize the genetic background involved in the 47
microevolution. Both intragenic and intergenic IS6110 locations resulted from these 48
microevolution events. Among those cases of IS6110 locations in intergenic regions, 49
which could have an effect on the regulation of adjacent genes, we identified 50
overexpression of cytochrome P450 in 1 microevolved variant using quantitative real-51
time RT-PCR. Our results help to define the frequency with which microevolution can 52
be expected in MTB transmission chains. They provide a snapshot of the genetic 53
background of these subtle rearrangements and identify an event in which IS6110-54
mediated microevolution on an isogenic background has functional consequences. 55
56
57
58
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 3: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/3.jpg)
3
Introduction 59
60
Mycobacterium tuberculosis (MTB) is characterized by high genetic 61
homogeneity (99.9% similarity at the nucleotide level) (40). Different mechanisms are 62
involved in the acquisition of variability in MTB and include single-nucleotide 63
polymorphisms, insertions, deletions, genomic rearrangements, and transpositions (23). 64
One of the mobile genetic elements involved in transposition events, the insertion 65
sequence IS6110 (22, 42) , is considered a key mechanism in the evolution of MTB. 66
IS6110 transposition events are not only responsible for the specific genomic 67
changes directly caused by insertion sequence mobility. Extensive chromosomal 68
rearrangements involving large deletions by IS6110-mediated homologous 69
recombination have also been described (10), and their entry can modify the expression 70
profiles of adjacent genes (32). 71
IS6110 has been used extensively as a genotypic marker in epidemiological 72
studies. Application of MTB fingerprinting based on IS6110 restriction fragment length 73
polymorphism (RFLP) has allowed us to refine identification of recent transmission 74
events. The MTB isolates of cases involved in a recent transmission chain generally 75
have identical fingerprints and thus constitute a cluster. However, it is also possible to 76
find one or several cases sharing genotyping patterns that are highly similar, but not 77
identical, to the pattern defining the cluster (7, 17, 45). 78
The existence of clonal variants in tuberculosis has been described in recurrent 79
episodes (19), in MTB isolates from a single episode, (4, 8, 11, 37, 38) , and in the 80
respiratory and extrarespiratory isolates of a single case (12). The presence of these 81
variants indicates a certain degree of genetic plasticity in MTB. Similarly, subtle 82
variations among the isolates involved in recent transmission chains could be the result 83
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 4: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/4.jpg)
4
of microevolution events selected by the sequential infection of independent hosts in a 84
transmission chain. 85
We describe the frequency of microevolution events in the recent transmission 86
chains of a population-based universal molecular epidemiology survey. We characterize 87
these events in detail in order to understand the genetic background involved in 88
microevolution and its potential functional significance. 89
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 5: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/5.jpg)
5
Material and Methods 90
91
Sample 92
93
Microevolution events were analyzed in a population sample (N: 612) that was 94
analyzed in the context of a universal-genotyping (applying IS6110-RFLP and MIRU-95
VNTR) molecular epidemiology survey between 2003 and 2008 in Almeria 96
(southeastern Spain, population 699,560)(20). The incidence of tuberculosis in this area 97
was 22.9 cases per 100,000 inhabitants, the highest in its Autonomous Community 98
(Andalusia) and one of the highest in Spain. 99
100
Genotyping Methods 101
102
IS6110-based RFLP typing 103
All the isolates were analyzed using IS6110 RFLP following international 104
standardization guidelines (43). RFLPtypes were used to establish identities/differences 105
only when they had more than 6 IS6110 copies. Phylogenetic analysis of the patterns 106
was performed with Bionumerics 4.6 (Applied Maths, Sint-Martens Laten, Belgium) 107
108
Mycobacterial interspersed repetitive units–variable-number tandem 109
repeat (MIRU-VNTR) typing 110
MIRU-VNTR with the 15-loci set (MIRU-15) (41) was applied for the isolates 111
clustered by IS6110-RFLP. 112
113
114
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 6: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/6.jpg)
6
115
116
Selection of clusters for analysis of microevolution 117
118
We selected clusters in which identical RFLPtypes and genotypic variants with 119
similar genotypes were observed. We studied those clusters including 4 or more cases in 120
which at least 2 isolates were identical by RFLP and MIRU (reference strain). The 121
genotypic variants (variant strain) within the cluster had to display differences in less 122
than 2 IS6110 bands and share MIRUtypes (or display single locus variants) with the 123
reference strain. Variants differing in 3 IS6110 bands were also considered, although 124
only when they shared identical MIRUtypes with the reference strain. 125
126
Ligation-mediated polymerase chain reaction (LM-PCR) 127
128
The protocol used is that described in Prod’hom et al. (29), with some 129
modifications. Briefly, DNA was digested with restriction enzyme SalI (Roche 130
Diagnostics GmbH, Penzberg, Germany) and ligated with adapter Saldg/Salpt by 131
incubation with T4 DNA ligase (New England Biolabs, Ipswich, Massachusetts, USA) 132
at 16°C overnight. PCR was performed using the primers ISA1 and ISA3 (25) and the 133
linker primer Saldg. Amplification was achieved using 35 PCR cycles (95ºC for 45 s, 134
65ºC for 45 s, and 72ºC for 8 min). The DNA polymerase used was AmpliTaq Gold 135
(Applied Biosystems, Foster City, California, USA). We performed LM-PCR using the 136
restriction enzyme XmaI (New England Biolabs), and XRxma24 137
(5´AGCACTCTCCAGCCTCTCAACGAC3´)/rxma12(5´CCGGGTCGTTGA3´) was 138
used as an adapter (del Portillo, unpublished). Amplified products were separated by 139
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 7: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/7.jpg)
7
electrophoresis in a 1.8% agarose gel and purified using GFX PCR DNA and the Gel 140
Band Purification Kit (GE Healthcare, Buckinghamshire, UK). The purified fragments 141
were sequenced using the ISA1 and ISA3 primers in a 3130xl Genetic Analyzer 142
(Applied Biosystems, Carlsbad, California, USA). The IS6110 insertion sites were 143
mapped taking as a reference the homology of the LM-PCR product sequences with the 144
H37Rv sequence genome in the TB Database (http://www.tbdb.org) (31). Once the 145
insertion sites were identified in clusters C and D, we confirmed the IS6110 location by 146
amplification with specific primers (designed to anneal within IS6110 and its adjacent 147
region) and subsequent sequencing. 148
In addition to mapping the IS6110 bands responsible for the differences between 149
the reference and variant strains within each cluster, additional bands (5-8) among those 150
shared by the reference strain and variant strain within each microevolved cluster were 151
mapped to confirm the certainty of clustering by identifying identical insertion sites. 152
153
Real-time RT-PCR 154
Isolation of RNA 155
MTB cultures were grown to the stationary phase (determined by CFUs plated 156
on Middlebrook 7H11 plates) in mycobacterial-growth-indicator-tube liquid media at 157
37ºC (Becton Dickinson, Sparks, Maryland, USA). The cultures were pelleted by 158
centrifugation (5 min, 14,000 rpm, 4ºC) and resuspended in guanidinium
thiocyanate 159
5M. Cells were disrupted using TRIzol reagent (Invitrogen, Carlsbad, California, USA) 160
and Fastprep (5 sec/6.5 w FP120 Bio 101 Savant, Vista, California, USA). Cell lysates 161
were recovered by centrifugation (10 min, 7500 g, 4ºC) and deproteinized using 162
chloroform. RNA was purified using an RNeasy total RNA kit (Qiagen GmbH, Hilden, 163
Germany) according to the manufacturer's instructions. DNase treatment was performed 164
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 8: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/8.jpg)
8
on-column. RNA underwent a second round of DNase treatment (Qiagen) for 15 min at 165
20°C and the samples were eluted in 40 µl of RNase-free water. 166
167
168
qRT-PCR 169
Quantitative reverse transcription-PCR was performed following a 1-step 170
method using the LightCycler RNA Master SYBR Green I kit (Roche). qRT-PCR 171
conditions were as follows: reverse transcription of template RNA (61ºC for 20 min), 172
denaturation of cDNA/RNA hybrid (95°C for 30 seconds), followed by 45 cycles of 173
95°C for 10 sec, 54°C for 10 sec, and 72ºC for 15 seconds. The specific primers for the 174
target genes used for RT-PCR were as follows: CYT F (Rv3121), 5´GGT TTA ATC 175
CGG CAA CTG AA 3´; CYT R (Rv3121), 5´TCG GAT TAC GTT CGA CAT CA 3´; 176
HP F (Rv3188), 5´CTG CTC TCG GAT TCG CTT AC 3´; and HP R (Rv3188), 5´GTA 177
GGC GCC GTC GAT AAA T 3´. The specificity of the PCR product was ensured by 178
post-PCR melting curve analysis and running the amplification product on a gel. 179
qRT-PCR assays from each strain were performed on 2 independent cultures and 180
the expression of the target genes was measured in 5 independent measurements. The 181
calculated threshold cycle (Ct) value for the target genes was normalized with respect to 182
the Ct value for 16S rRNA (14). 183
184
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 9: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/9.jpg)
9
Results 185
186
Identification and description of microevolution events 187
188
Our first objective was to measure the frequency of microevolution in a 189
universal genotyping scheme from a population sample and describe the general 190
features of the clusters that underwent these genotypic changes. 191
Of the 612 MTB isolates genotyped during the study period, 231 (37.7%) were 192
grouped in 74 clusters (2-9 members), as defined by IS6110-RFLP. Microevolution 193
events were identified in 9 clusters (12%), which involved 4-9 cases occurring over a 1 194
to 5–year period (Table 1 and Figure 1). The number of IS6110 copies for the clusters 195
with or without microevolution was not markedly different (9-17, median: 12; 7-15, 196
median 10, respectively). Proved or probable epidemiological links were found in all 197
the clusters with microevolution for which detailed epidemiological information was 198
available (Figure 1). In 3 clusters (B, E, and G), 2 variants were considered in addition 199
to the reference strain; for the remaining 6 clusters, only 1 clonal variant was found. 200
Among the 12 clonal variants identified by RFLP, differences in the MIRUtypes 201
involving a single locus were also found in 2 cases (Figure 1). Additionally, MIRU 202
analysis split the reference pattern of 4 clusters in 2 MIRUtypes differing in a single 203
locus. Three clusters involved only Spanish cases, 1 cluster Moroccan cases, and the 204
remaining clusters were multinational (Figure 1). In 4 of the microevolved clusters, a 205
delay in administering therapy was recorded for some of the cases. All the isolates were 206
susceptible to INH and RIF, except one representative of the reference strain in cluster 207
H which was INH-resistant. 208
209
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 10: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/10.jpg)
10
210
211
Genotypic characterization of the microevolution phenomena 212
213
Our second objective was to map the IS6110 insertion sites responsible for the 214
differences between RFLP patterns in the clonal variants selected in order to identify the 215
genetic background involved in the microevolution events. The analysis could not be 216
performed in 2 of the 9 clusters (clusters A and E; Figure 1) due to lack of viability in 217
some of the isolates. IS6110 insertion sites were mapped in the 16 representative 218
isolates of the reference strain and variants observed in the analyzed clusters (Figure 1). 219
The results for IS6110 mapping of the differential IS6110 bands are compiled in 220
Figure 2. Of the IS6110 bands differing with respect to the RFLP pattern defining the 221
cluster, 3 were intragenic and interrupted coding regions and the remaining 9, which led 222
to differential RFLP hybridization bands, mapped in intergenic regions that were 223
potentially involved in the regulation of the downstream genes (Figure 2). In the 224
intergenic regions, the promoter from IS6110 was oriented with the adjacent gene (ie, 225
potential up-regulation) in 5 cases (68-422 nucleotides before), whereas in the 226
remaining 4 it was oriented in the opposite direction (at 39-404 nucleotides) (ie, 227
potential down-regulation) (Figure 2). All 45 analyzed controls shared IS6110 bands 228
that mapped in identical coordinates for the reference and variant strains. 229
230
Analysis of the effect of the insertion sequence IS6110 on the regulation of transcription 231
of downstream genes 232
Five IS6110 locations (Figure 2) involved in microevolution events mapped in 233
potential regulatory regions which were located at a distance and orientation that were 234
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 11: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/11.jpg)
11
compatible with up-regulation of the downstream genes by the promoter included in 235
IS6110 (32). Our final objective was to document whether this potential regulation 236
could occur. Therefore, we selected 2 clusters (C and D) as representatives of those in 237
which the entry of IS6110 into the microevolved variant was duly oriented and at a 238
suitable distance from the downstream genes. 239
Relative quantification assays were performed based on real-time RT-PCR with 240
the isolate that was representative of each of the 2 clusters selected and its 241
corresponding variants targeting the expression of the corresponding genes located 242
downstream and coding for CYP141 (Rv3121) in cluster C and for a hypothetical 243
protein (Rv3188) in cluster D. A Wilcoxon–Mann-Whitney test was used to assess 244
differences in the expression of the studied genes. No differences were found in Rv3188 245
expression between the reference and variant strains. However, for Rv3121 (CYP141), 246
higher expression levels (a 5.6-fold difference) were recorded when the median 247
expression values measured for the variant were compared with the reference strain 248
(p<0.05; Figure 3). 249
250
251
252
253
254
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 12: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/12.jpg)
12
Discussion 255
256
Several studies have found exceptions to the assumption that infection by MTB 257
involves a genetically homogeneous population of bacilli. The extensive application of 258
IS6110-RFLP as a genotyping tool has revealed the existence of clonal variants from a 259
common ancestor resulting from microevolution phenomena within individuals (1, 6, 260
12, 13, 34, 37) . RFLP-defined clonal variants have also appeared in transmission 261
chains or in outbreaks involving susceptible or resistant strains (2, 13, 26, 28, 36, 45). 262
The existence of microevolution from an initial strain due to sequential host-to-host 263
infection led to the proposal that, if only identical genotypes are considered to define 264
clusters, the percentage of recent transmission in a population is underestimated, 265
because epidemiological links are also found between cases infected by strains with 266
RFLP patterns showing a certain degree of variation (7, 17, 45). 267
Most publications on microevolution in tuberculosis are case reports, except for 268
the few systematic studies based on population samples (7, 8, 21, 37). Consequently, it 269
is difficult to appreciate the true dimension of microevolution. The primary objective of 270
our study was to screen microevolution phenomena at the population level. We found 271
that 12% of the clusters grouping identical patterns in a 5-year universal genotyping-272
based molecular epidemiology survey in southeastern Spain (20) also grouped some 273
clonal variants, indicating that this is not an anecdotal phenomenon. We decided to 274
define clonal variants according to differences in the RFLP patterns, although variants 275
can also involve diverse genetic targets applied for epidemiological purposes other than 276
IS6110, such as MIRU sites or the spacers at the DR region, thus increasing the rate at 277
which clonal variants could be found in transmission chains. In our clusters showing 278
RFLP variants, differences were also observed at individual MIRU loci. Clonal variants 279
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 13: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/13.jpg)
13
with simultaneous variation in RFLP and MIRU have been identified elsewhere (1, 15, 280
37). Among the clusters considered representative of microevolution, we found 281
differences in 1-3 RFLP bands. Variations in up to 4 IS6110 bands between 282
epidemiologically linked cases have been found in other studies (13). We found 283
epidemiological links between patients in all but one of the selected microevolved 284
clusters. The number of IS6110 bands in the shared patterns was >8 and mapping of a 285
high number of shared IS6110 bands between the reference strain and the variants 286
reinforced the observation that co-migrating IS6110 bands corresponded to identical 287
insertion sites, thus supporting the genotypic relationship between them and the 288
existence of a transmitted common ancestor undergoing genotypic changes through 289
microevolution phenomena. 290
The appearance of clonal variants in MTB can be facilitated by a series of 291
factors. The existence of a long delay between infection and diagnosis of TB enables the 292
infecting bacterial population to increase in size and provides sufficient time for 293
microevolution (1). Furthermore, the longer the transmission chain or the higher the 294
number of clustered cases, the higher the possibility of finding clonal variants as a result 295
of the length of time to microevolution, the sequential adaptation to multiple 296
independent hosts, or both. In our study, microevolution leading to clonal variants was 297
not restricted to these scenarios, but was detected in different types of clusters, 298
including the lowest number of cases (4 cases), in clusters from 1 to 5 years long, and in 299
clusters involving Spanish-born patients, clusters involving single-nationality immigrant 300
cases, and in multinational clusters. Moreover, in most of the patients involved in 301
microevolved clusters, diagnostic delay was rare, and in the few cases where it occurred 302
it was too short (less than 3 months), thus making it an unlikely explanation for the 303
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 14: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/14.jpg)
14
variations observed. Taken together, our data suggest that microevolution may not be 304
restricted to specific clinical/epidemiological circumstances. 305
Apart from the usefulness of targeting IS6110 bands to identify microevolution, 306
we must remember that modifications in IS6110 insertion sites can have genetic 307
consequences. IS6110 can directly disrupt genes when it is located intragenically and its 308
entry can modulate expression of adjacent genes when it enters intergenic regions (23, 309
33).. 310
The systematic application of LM-PCR allowed us not only to confirm the 311
clonal relatedness of the isolates involved in the microevolved clusters, but also to know 312
the genetic background involved in the IS6110-mediated microevolution events 313
observed in transmission chains. Unlike other studies analyzing the role of IS6110 314
sequences in specific strains by comparing with fully unrelated control strains, ours was 315
a unique opportunity to evaluate the relevance of specific IS6110 insertions in an 316
isogenic background (ie, one shared by the reference strain and variant strain). In this 317
context, the identification of a new microevolved variant strain by a new IS6110-318
transposition event in the reference strain suggests that the entry of IS6110 is 319
advantageous. The IS6110 mobilization event is expected to occur initially in a single 320
bacterium and, if we can detect it in the transmission chain, it may indicate that the 321
variant strain has been positively selected in the host case to enrich its 322
representativeness and to enable its transmission. 323
We observed both intragenic and intergenic locations for the IS6110 sequences 324
involved in microevolution events. The genes disrupted by the intragenic entry of 325
IS6110 in our study were previously found to be interrupted in other analyzed strains 326
(35) and, as generally occurs with intragenic entry of IS6110, corresponded to 327
redundant genes; therefore, the loss of gene expression does not become deleterious for 328
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 15: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/15.jpg)
15
the strain, although we cannot rule out some effect due to this IS6110-mediated 329
inactivation. In other cases, mobilization of IS6110 into intragenic regions could have 330
an effect other than inactivation, and it is also possible to find a functional phenotype 331
associated with a single IS6110-disrupted copy of a redundant gene. This could be the 332
case, for example, of the microevolution event involving an IS6110 insertion in a PPE 333
gene, which could disrupt antigenic determinants in an attempt to evade the immune 334
response (23), as suggested by the frequent finding of IS6110 insertions in the PE/PPE 335
gene family described for clinical isolates (46). 336
The majority of IS6110 locations involved in microevolution mapped in 337
intergenic regions as has been found previously in clinical isolates (46). Unlike 338
intragenic locations of IS6110, which systematically disrupt the genes involved, entry 339
into intergenic regions could lead to a variety of effects, by either direct impairment of 340
existing promoters or by driving expression using a promoter included in IS6110 itself 341
(3, 5, 32, 39),. The distances between IS6110 and the adjacent genes in our study were 342
variable, but within the range for modulation of expression. The regions involved in the 343
regulation of transcription of a specific gene are rather extensive and include not only 344
the promoter itself, but also distanced regions with a role in secondary structure 345
regulatory interactions or binding of transcription factors. 346
In our analysis, 3 cases in which transposition of IS6110 could modulate 347
adjacent gene expression involved hypothetical proteins (Rv3188, Rv1762, and 348
Rv1504) with an unknown role. However, in some of the remaining cases, IS6110 was 349
adjacent to genes encoding proteins with well known functions, as follows: i) esxK 350
(early secreted antigenic target), which belongs to the ESAT-6 family of proteins, a 351
group of immunodominant MTB antigens that are relevant in virulence (16, 30); ii) 352
dnaA-dnaN intergenic region, which includes the oriC locus, a preferential site for 353
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 16: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/16.jpg)
16
IS6110 insertion (18) that is downregulated in hypoxia (9); iii) PPE29, a member of the 354
PPE/PE protein family, whose expression is controlled by diverse factors and which 355
induces dynamic antigenic pattern modification depending on host microenvironments 356
(44), thus helping to evade the immune response; and iv) Rv3121, coding for the protein 357
CYP141, one of 20 cytochrome P450 enzymes that exist in the genome of MTB and are 358
physiologically relevant mono-oxygenases involved in catabolic pathways (24) related 359
to viability and virulence, thus making them good candidates as drug targets (27). 360
Expression of the adjacent gene must be measured to clarify the specific effect 361
expected for intergenic entry. In our study, we selected 2 clusters as representative of 362
microevolutions involving entry of IS6110 in intergenic regions according to the 363
orientation of the promoter included in IS6110 (OPIS6110) and the distance between 364
the promoter and the adjacent gene (a hypothetical protein and CYP141). Differences in 365
cytochrome P450 expression were found between the variant and the reference strain, 366
thus indicating that microevolution events can have a functional consequence and are 367
not always meaningless subtle variations. Given the proper proximity and orientation of 368
the OPIS6110 promoter included in the transposable sequence, which is known to be 369
upregulated during the stationary phase in broth culture (32), the entry of IS6110 led to 370
increased expression of the downstream gene (CYP141). 371
We estimated the frequency with which microevolution can be expected in 372
tuberculosis transmission chains at population level and showed that it is not restricted 373
to specific clinical-epidemiological circumstances. The microevolution mediated by 374
IS6110 transposition detected here involves a variety of intragenic and intergenic 375
genetic backgrounds. Functional consequences of the differential location of an IS6110 376
copy on an isogenic background were observed in one of the microevolution events. 377
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 17: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/17.jpg)
17
Further studies will help us to explore the as yet unrevealed meaning of microevolution 378
in MTB. 379
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 18: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/18.jpg)
18
Figures 380
381
Figure 1: Clusters including isolates sharing identical RFLPtypes (RS: reference strain) 382
together with clonal variants (V). Numbers in parenthesis indicate the number of cases. 383
Different RFLP bands between the reference strains and variant strains are indicated by 384
asterisks. Allelic differences between the MIRUtypes of their reference and variant 385
strains are highlighted in bold. 386
Figure 2: Compilation of the IS6110 location sites mapped for the clusters with 387
microevolution. The arrows indicate the direction of the transcription mediated by 388
IS6110. nts: nucleotides 389
Figure 3: Box plot of the distribution of expression ratios for the reference strains and 390
variant strains from cluster C, which lacked or included IS6110, respectively, upstream 391
of Rv3121. 392
393
394
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 19: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/19.jpg)
19
395
396
Acknowledgements 397
We are grateful to Ainhoa Simón Zárate, who holds a grant from the Fondo de 398
Investigaciones Sanitarias (Línea Instrumental Secuenciación), and Milagros González 399
for their participation in the sequencing analysis. The 3130xl Genetic Analyzer was 400
partially financed by grants from Fondo de Investigaciones Sanitarias (IF01-3624, IF08-401
36173). Laura Pérez holds a Juan de la Cierva contract from Ministerio de Ciencia e 402
Innovación (Ref JCI-2009-05713). This study was partially supported by Fondo de 403
Investigaciones Sanitarias (S09/02205). We are grateful to Beatriz Pérez from the 404
National Epidemiology Center and Jose María Bellón from HGUGM for performing the 405
statistical analysis. We thank Thomas O’Boyle for proofreading the manuscript. 406
407
408
409
410
411
412
413
414
415
416
417
418
419
420
421
422
423
424
425
426
427
428
429
430
431
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 20: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/20.jpg)
20
References 432
433
434
435
436
437
1. Al-Hajoj, S. A., O. Akkerman, I. Parwati, S. al-Gamdi, Z. Rahim, D. van 438
Soolingen, J. van Ingen, P. Supply, and A. G. van der Zanden. 2010. 439
Microevolution of Mycobacterium tuberculosis in a tuberculosis patient. J Clin 440
Microbiol 48:3813-6. 441
2. Alito, A., N. Morcillo, S. Scipioni, A. Dolmann, M. I. Romano, A. Cataldi, 442
and D. van Soolingen. 1999. The IS6110 restriction fragment length 443
polymorphism in particular multidrug-resistant Mycobacterium tuberculosis 444
strains may evolve too fast for reliable use in outbreak investigation. J Clin 445
Microbiol 37:788-91. 446
3. Alonso, H., J. I. Aguilo, S. Samper, J. A. Caminero, M. I. Campos-Herrero, 447
B. Gicquel, R. Brosch, C. Martin, and I. Otal. 2011. Deciphering the role of 448
IS6110 in a highly transmissible Mycobacterium tuberculosis Beijing strain, 449
GC1237. Tuberculosis (Edinb) 91:117-26. 450
4. Andrade, M. K., S. M. Machado, M. L. Leite, and M. H. Saad. 2009. 451
Phenotypic and genotypic variant of MDR-Mycobacterium tuberculosis multiple 452
isolates in the same tuberculosis episode, Rio de Janeiro, Brazil. Braz J Med 453
Biol Res 42:433-7. 454
5. Beggs, M. L., K. D. Eisenach, and M. D. Cave. 2000. Mapping of IS6110 455
insertion sites in two epidemic strains of Mycobacterium tuberculosis. J Clin 456
Microbiol 38:2923-8. 457
6. Braden, C. R., G. P. Morlock, C. L. Woodley, K. R. Johnson, A. C. 458
Colombel, M. D. Cave, Z. Yang, S. E. Valway, I. M. Onorato, and J. T. 459 Crawford. 2001. Simultaneous infection with multiple strains of 460
Mycobacterium tuberculosis. Clin Infect Dis 33:e42-7. 461
7. Cave, M. D., Z. H. Yang, R. Stefanova, N. Fomukong, K. Ijaz, J. Bates, and 462
K. D. Eisenach. 2005. Epidemiologic import of tuberculosis cases whose 463
isolates have similar but not identical IS6110 restriction fragment length 464
polymorphism patterns. J Clin Microbiol 43:1228-33. 465
8. Cohen, T., D. Wilson, K. Wallengren, E. Y. Samuel, and M. Murray. 2011. 466
Mixed-strain Mycobacterium tuberculosis infections among patients dying in a 467
hospital in KwaZulu-Natal, South Africa. J Clin Microbiol 49:385-8. 468
9. Chauhan, S., and J. S. Tyagi. 2011. Analysis of transcription at the oriC locus 469
in Mycobacterium tuberculosis. Microbiol Res. 470
10. Fang, Z., C. Doig, D. T. Kenna, N. Smittipat, P. Palittapongarnpim, B. 471
Watt, and K. J. Forbes. 1999. IS6110-mediated deletions of wild-type 472
chromosomes of Mycobacterium tuberculosis. J Bacteriol 181:1014-20. 473
11. Garcia de Viedma, D., N. Alonso Rodriguez, S. Andres, M. J. Ruiz Serrano, 474
and E. Bouza. 2005. Characterization of clonal complexity in tuberculosis by 475
mycobacterial interspersed repetitive unit-variable-number tandem repeat 476
typing. J Clin Microbiol 43:5660-4. 477
12. Garcia de Viedma, D., M. Marin, S. Andres, G. Lorenzo, M. J. Ruiz-478
Serrano, and E. Bouza. 2006. Complex clonal features in an mycobacterium 479
tuberculosis infection in a two-year-old child. Pediatr Infect Dis J 25:457-9. 480
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 21: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/21.jpg)
21
13. Glynn, J. R., M. D. Yates, A. C. Crampin, B. M. Ngwira, F. D. Mwaungulu, 481
G. F. Black, S. D. Chaguluka, D. T. Mwafulirwa, S. Floyd, C. Murphy, F. A. 482 Drobniewski, and P. E. Fine. 2004. DNA fingerprint changes in tuberculosis: 483
reinfection, evolution, or laboratory error? J Infect Dis 190:1158-66. 484
14. Haile, Y., G. Bjune, and H. G. Wiker. 2002. Expression of the mceA, esat-6 485
and hspX genes in Mycobacterium tuberculosis and their responses to aerobic 486
conditions and to restricted oxygen supply. Microbiology 148:3881-6. 487
15. Hawkey, P. M., E. G. Smith, J. T. Evans, P. Monk, G. Bryan, H. H. 488
Mohamed, M. Bardhan, and R. N. Pugh. 2003. Mycobacterial interspersed 489
repetitive unit typing of Mycobacterium tuberculosis compared to IS6110-based 490
restriction fragment length polymorphism analysis for investigation of 491
apparently clustered cases of tuberculosis. J Clin Microbiol 41:3514-20. 492
16. Hsu, T., S. M. Hingley-Wilson, B. Chen, M. Chen, A. Z. Dai, P. M. Morin, 493
C. B. Marks, J. Padiyar, C. Goulding, M. Gingery, D. Eisenberg, R. G. 494
Russell, S. C. Derrick, F. M. Collins, S. L. Morris, C. H. King, and W. R. 495 Jacobs, Jr. 2003. The primary mechanism of attenuation of bacillus Calmette-496
Guerin is a loss of secreted lytic function required for invasion of lung 497
interstitial tissue. Proc Natl Acad Sci U S A 100:12420-5. 498
17. Ijaz, K., Z. Yang, H. S. Matthews, J. H. Bates, and M. D. Cave. 2002. 499
Mycobacterium tuberculosis transmission between cluster members with similar 500
fingerprint patterns. Emerg Infect Dis 8:1257-9. 501
18. Kurepina, N. E., S. Sreevatsan, B. B. Plikaytis, P. J. Bifani, N. D. Connell, 502
R. J. Donnelly, D. van Sooligen, J. M. Musser, and B. N. Kreiswirth. 1998. 503
Characterization of the phylogenetic distribution and chromosomal insertion 504
sites of five IS6110 elements in Mycobacterium tuberculosis: non-random 505
integration in the dnaA-dnaN region. Tuber Lung Dis 79:31-42. 506
19. Martin, A., M. Herranz, Y. Navarro, S. Lasarte, M. J. Serrano, E. Bouza, 507
and D. G. de Viedma. 2011. Evaluation of the inaccurate assignment of mixed 508
infections by Mycobacterium tuberculosis as exogenous reinfection and analysis 509
of the potential role of bacterial factors in reinfection. J Clin Microbiol 49:1331-510
8. 511
20. Martinez-Lirola, M., N. Alonso-Rodriguez, M. L. Sanchez, M. Herranz, S. 512
Andres, T. Penafiel, M. C. Rogado, T. Cabezas, J. Martinez, M. A. Lucerna, 513 M. Rodriguez, C. Bonillo Mdel, E. Bouza, and D. Garcia de Viedma. 2008. 514
Advanced survey of tuberculosis transmission in a complex socioepidemiologic 515
scenario with a high proportion of cases in immigrants. Clin Infect Dis 47:8-14. 516
21. Mathema, B., P. J. Bifani, J. Driscoll, L. Steinlein, N. Kurepina, S. L. 517
Moghazeh, E. Shashkina, S. A. Marras, S. Campbell, B. Mangura, K. 518 Shilkret, J. T. Crawford, R. Frothingham, and B. N. Kreiswirth. 2002. 519
Identification and evolution of an IS6110 low-copy-number Mycobacterium 520
tuberculosis cluster. J Infect Dis 185:641-9. 521
22. McAdam, R. A., P. W. Hermans, D. van Soolingen, Z. F. Zainuddin, D. 522
Catty, J. D. van Embden, and J. W. Dale. 1990. Characterization of a 523
Mycobacterium tuberculosis insertion sequence belonging to the IS3 family. 524
Mol Microbiol 4:1607-13. 525
23. McEvoy, C. R., A. A. Falmer, N. C. Gey van Pittius, T. C. Victor, P. D. van 526
Helden, and R. M. Warren. 2007. The role of IS6110 in the evolution of 527
Mycobacterium tuberculosis. Tuberculosis (Edinb) 87:393-404. 528
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 22: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/22.jpg)
22
24. McLean, K. J., D. Clift, D. G. Lewis, M. Sabri, P. R. Balding, M. J. 529
Sutcliffe, D. Leys, and A. W. Munro. 2006. The preponderance of P450s in the 530
Mycobacterium tuberculosis genome. Trends Microbiol 14:220-8. 531
25. Mendiola, M. V., C. Martin, I. Otal, and B. Gicquel. 1992. Analysis of the 532
regions responsible for IS6110 RFLP in a single Mycobacterium tuberculosis 533
strain. Res Microbiol 143:767-72. 534
26. Namouchi, A., R. Haltiti, D. Hawari, and H. Mardassi. 2010. Re-emergence 535
of the progenitors of a multidrug-resistant outbreak strain of Mycobacterium 536
tuberculosis among the post-outbreak case patients. J Infect Dis 201:390-8. 537
27. Ouellet, H., J. B. Johnston, and P. R. Ortiz de Montellano. 2010. The 538
Mycobacterium tuberculosis cytochrome P450 system. Arch Biochem Biophys 539
493:82-95. 540
28. Perri, B. R., D. Proops, P. K. Moonan, S. S. Munsiff, B. N. Kreiswirth, C. 541
Goranson, and S. D. Ahuja. 2011. Mycobacterium tuberculosis cluster with 542
developing drug resistance, New York, New York, USA, 2003-2009. Emerg 543
Infect Dis 17:372-8. 544
29. Prod'hom, G., C. Guilhot, M. C. Gutierrez, A. Varnerot, B. Gicquel, and V. 545
Vincent. 1997. Rapid discrimination of Mycobacterium tuberculosis complex 546
strains by ligation-mediated PCR fingerprint analysis. J Clin Microbiol 35:3331-547
4. 548
30. Pym, A. S., P. Brodin, R. Brosch, M. Huerre, and S. T. Cole. 2002. Loss of 549
RD1 contributed to the attenuation of the live tuberculosis vaccines 550
Mycobacterium bovis BCG and Mycobacterium microti. Mol Microbiol 46:709-551
17. 552
31. Reddy, T. B., R. Riley, F. Wymore, P. Montgomery, D. DeCaprio, R. 553
Engels, M. Gellesch, J. Hubble, D. Jen, H. Jin, M. Koehrsen, L. Larson, M. 554
Mao, M. Nitzberg, P. Sisk, C. Stolte, B. Weiner, J. White, Z. K. Zachariah, 555 G. Sherlock, J. E. Galagan, C. A. Ball, and G. K. Schoolnik. 2009. TB 556
database: an integrated platform for tuberculosis research. Nucleic Acids Res 557
37:D499-508. 558
32. Safi, H., P. F. Barnes, D. L. Lakey, H. Shams, B. Samten, R. Vankayalapati, 559
and S. T. Howard. 2004. IS6110 functions as a mobile, monocyte-activated 560
promoter in Mycobacterium tuberculosis. Mol Microbiol 52:999-1012. 561
33. Sampson, S., R. Warren, M. Richardson, G. van der Spuy, and P. van 562
Helden. 2001. IS6110 insertions in Mycobacterium tuberculosis: predominantly 563
into coding regions. J Clin Microbiol 39:3423-4. 564
34. Sampson, S. L., M. Richardson, P. D. Van Helden, and R. M. Warren. 2004. 565
IS6110-mediated deletion polymorphism in isogenic strains of Mycobacterium 566
tuberculosis. J Clin Microbiol 42:895-8. 567
35. Sampson, S. L., R. M. Warren, M. Richardson, G. D. van der Spuy, and P. 568
D. van Helden. 1999. Disruption of coding regions by IS6110 insertion in 569
Mycobacterium tuberculosis. Tuber Lung Dis 79:349-59. 570
36. Schurch, A. C., K. Kremer, O. Daviena, A. Kiers, M. J. Boeree, R. J. Siezen, 571
and D. van Soolingen. 2010. High-resolution typing by integration of genome 572
sequencing data in a large tuberculosis cluster. J Clin Microbiol 48:3403-6. 573
37. Shamputa, I. C., L. Jugheli, N. Sadradze, E. Willery, F. Portaels, P. Supply, 574
and L. Rigouts. 2006. Mixed infection and clonal representativeness of a single 575
sputum sample in tuberculosis patients from a penitentiary hospital in Georgia. 576
Respir Res 7:99. 577
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 23: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/23.jpg)
23
38. Shamputa, I. C., L. Rigouts, L. A. Eyongeta, N. A. El Aila, A. van Deun, A. 578
H. Salim, E. Willery, C. Locht, P. Supply, and F. Portaels. 2004. Genotypic 579
and phenotypic heterogeneity among Mycobacterium tuberculosis isolates from 580
pulmonary tuberculosis patients. J Clin Microbiol 42:5528-36. 581
39. Soto, C. Y., M. C. Menendez, E. Perez, S. Samper, A. B. Gomez, M. J. 582
Garcia, and C. Martin. 2004. IS6110 mediates increased transcription of the 583
phoP virulence gene in a multidrug-resistant clinical isolate responsible for 584
tuberculosis outbreaks. J Clin Microbiol 42:212-9. 585
40. Sreevatsan, S., X. Pan, K. E. Stockbauer, N. D. Connell, B. N. Kreiswirth, 586
T. S. Whittam, and J. M. Musser. 1997. Restricted structural gene 587
polymorphism in the Mycobacterium tuberculosis complex indicates 588
evolutionarily recent global dissemination. Proc Natl Acad Sci U S A 94:9869-589
74. 590
41. Supply, P., C. Allix, S. Lesjean, M. Cardoso-Oelemann, S. Rusch-Gerdes, E. 591
Willery, E. Savine, P. de Haas, H. van Deutekom, S. Roring, P. Bifani, N. 592
Kurepina, B. Kreiswirth, C. Sola, N. Rastogi, V. Vatin, M. C. Gutierrez, M. 593
Fauville, S. Niemann, R. Skuce, K. Kremer, C. Locht, and D. van Soolingen. 594 2006. Proposal for standardization of optimized mycobacterial interspersed 595
repetitive unit-variable-number tandem repeat typing of Mycobacterium 596
tuberculosis. J Clin Microbiol 44:4498-510. 597
42. Thierry, D., M. D. Cave, K. D. Eisenach, J. T. Crawford, J. H. Bates, B. 598
Gicquel, and J. L. Guesdon. 1990. IS6110, an IS-like element of 599
Mycobacterium tuberculosis complex. Nucleic Acids Res 18:188. 600
43. van Embden, J. D., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, 601
B. Gicquel, P. Hermans, C. Martin, R. McAdam, T. M. Shinnick, and et al. 602 1993. Strain identification of Mycobacterium tuberculosis by DNA 603
fingerprinting: recommendations for a standardized methodology. J Clin 604
Microbiol 31:406-9. 605
44. Voskuil, M. I., D. Schnappinger, R. Rutherford, Y. Liu, and G. K. 606
Schoolnik. 2004. Regulation of the Mycobacterium tuberculosis PE/PPE genes. 607
Tuberculosis (Edinb) 84:256-62. 608
45. Warren, R. M., G. D. van der Spuy, M. Richardson, N. Beyers, C. Booysen, 609
M. A. Behr, and P. D. van Helden. 2002. Evolution of the IS6110-based 610
restriction fragment length polymorphism pattern during the transmission of 611
Mycobacterium tuberculosis. J Clin Microbiol 40:1277-82. 612
46. Yesilkaya, H., J. W. Dale, N. J. Strachan, and K. J. Forbes. 2005. Natural 613
transposon mutagenesis of clinical isolates of Mycobacterium tuberculosis: how 614
many genes does a pathogen need? J Bacteriol 187:6726-32. 615
616
617
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 24: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/24.jpg)
Total number of clusters
Clusters without RFLP
modification
14
3
1
3
2
9
2
-
2
1
5 (C, D, G, H, I)
1 (A)
1 (F)
1 (E)
1 (B)
4 members
5 members
6 members
7 members
9 members
Clusters with RFLP microevolution
events
Table 1: Distribution of IS6110 RFLP-defined clusters according to the existence
of microevolved clonal variants. RFLP, restriction fragment length polymorphism.
Letters in brackets correspond to cluster codes in Figure 1.
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 25: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/25.jpg)
Figure 1
A
(29)254333342123359 5 years
Morocco (3)
Romania(1)
Spain (1)
NO YES (3)RS (4)
V1 (1)
*
5 yearsB
(30)
Spain (6)
Ghana (1)
Nigeria (1)
Senegal (1)
YES (3)252243242242325 YES (9)
***
RS (7)
V1 (1)
V2 (1)
*
RS (3)
V1 (1)
C
(46)Spain YES (2)NO 5 years
158333343232523RS:
V1:
158333343242523
158333343232523
***
RS (3)
V1 (1)
D
(625)Morocco (3)
Spain (1)2 years YES (2) YES (3)
254313243252425RS:
254313343252425
254313243252425V1:
E
(280)5 years YES (3)Morocco YES (7)
RS (4)
V1 (2)
V2 (1)
* ** 264233342123235RS:
V2: 264433342123235264433342123235
*RS (5)
V1 (1)
F
(633)
Argentina (1)
Gambia (1)
Romania(1)
Spain (3)
NO 2 years YES (6)252343232242325
252343232232325
RS:
V1:
5 yearsH
(450)Spain YES (3)YES (1)
*
RS (3)
V1 (1)
253533233443337
253533233443347
253533233443337
RS:
V1:
3 yearsI
(427)Spain (2)
Morocco (2)NO NO 254423422212326
*RS (3)
V1 (1)
1 yearG
(500) Spain241423242122234 NO YES (3)
RS (2)
V1 (1)
V2 (1)
* *
MIRUtype 15 PeriodCluster
(ref number)
Epidemiological
linksRFLP patternPatientorigin
Diagnostic delay
(months)
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 26: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/26.jpg)
D
D Rv2283
LipM
Rv2284
Rv1752
PPE 24
Rv1753c
FConserved hypothetical
protein
Rv3179 Rv3180c
Intragenic locations
G
C
B
H
D
Cytochrome p450
280 nts
Rv3120 Rv3121
Conserved
hypothetical
protein
Transposase
Rv3187 Rv3188
231 nts
PPE28 181 nts PPE29
Rv1800 Rv1801
dnaA 422 nts dnaN
Rv0001 Rv0002
Rv1197
PPE 18 68 nts esxK
Rv1196
Intergenic locations
G
B
B
I
dnaA 404 nts dnaN
Rv0001 Rv0002
Hypothetical
protein274 nts
Rv1762c Rv1765c
Membrane protein
Membrane protein
68 nts
Rv0010c Rv0011c
39 ntsConserved
hypothetical
protein
Rv1504c Rv1505c
Potential down-regulationPotential up-regulationCluster Cluster Cluster Interrupted gene
Figure 2
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
![Page 27: 1 Characterization of microevolution events in …jcm.asm.org/content/early/2011/09/21/JCM.01285-11.full.pdf · 37 Mycobacterium tuberculosis (MTB) infecting a single patient, probably](https://reader031.vdocuments.us/reader031/viewer/2022022603/5b5cc0417f8b9a65028c7155/html5/thumbnails/27.jpg)
0.0
02
.004
.006
Reference Strain Variant Strain
Figure 3
Expre
ssio
nra
tio
on July 28, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from