Supplemental Data

Li et al. BZR1 Positively Regulates Freezing Tolerance via CBF-Dependent and CBF-Independent Pathways in Arabidopsis

Figure S1. Expression of BIN2 in BIN2-Overexpressing Plants.(A) Expression of BIN2 in BIN2-overexpressing plants by qRT-PCR. Transgenic plants overexpressing BIN2-Myc driven by super promoter (BIN2-OE1 and BIN2-OE15) were grown on 1/2 MS plates at 22°C for two weeks. Total RNA was extracted and subjected to qRT-PCR analysis. The expression level of BIN2 in the wild type was set as 1.0. Data are mean ± SD of three technical replicates. Similar results were obtained from three biological replicates. (B) The protein levels of BIN2 in BIN2-overexpressing plants. Total proteins were prepared from two-week-old wild type and Super:BIN2-Myc transgenic plants, and subjected to western blot analysis. BIN2 protein was detected with anti-Myc antibody.

Figure S2. Freezing Phenotypes of bin2-3 Mutant.(A) Freezing phenotypes of bin2-3 mutant under non-acclimated and acclimated conditions. Two-week-old WT and bin2-3 mutant grown on 1/2 MS plates at 22°C were treated at -3°C for 1 h for non-acclimated plants and at -6°C for 1 h for acclimated plants (CA; 3 d at 4°C).(B) Survival rates of bin2-3 mutant and under non-acclimated and acclimated conditions described in (A).(C) The electrolyte leakage assay of bin2-3 mutant at the indicated freezing temperatures. In (B and C), the data are the mean values of three replicates ± SD. Three independent experiments were done with similar results.

Figure S3. Quality Test of Anti-BZR1 Antibody. The 130-308aa BZR1 peptide was selected as the epitope. Total proteins extracted from plants treated with 1 M EBR for 2 h were used for examination of anti-BZR1 antibody specificity, plants treated with DMSO for 2 h plants are shown as controls. Total proteins extracted from Col-0 treated with CIAP for 30 min was performed to show that specific variant bands are due to phosphorylation, untreated proteins are shown as controls (CK). BZR1 proteins were immunologically detected using the anti-BZR1 antibody.

Figure S4. Functional Categorization Analysis of BES1 Candidate Target Genes.

Figure S5. BES1 Binds to the Promoters of CBF1 and CBF2.(A) EMSA assay of BES1 binding to the promoters of CBF1 and CBF2 genes. Biotin-labeled fragments representing parts of CBF1 and CBF2 that contain an E-box were incubated with MBP or MBP-BES1 protein. Competitor or mutated competitor fragments were added in 100 × or 300 × excess to analyze the specificity of binding.(B) GUS transactivation assays in Arabidopsis protoplasts. The promoters of CBF1 (left) and CBF2 (right) fused to the GUS gene as a reporter were transiently expressed in protoplasts either alone (control) or with BES1 as an effector at 22°C for 16 h.

Figure S6. Expression of CBF target genes in bzr1-1D cbfs-1 quadruple mutant. Expression of CBF target genes in the bzr1-1D cbfs-1 quadruple mutant under cold stress. The 2-week-old plants grown on 1/2 MS plates at 22°C were treated at 4°C for the indicated time. Total RNAs were extracted and subjected to qRT-PCR analysis. The expression levels of the genes in the wild type at 22°C were set as 1.0. Data are mean of three replicates ± SD. *P < 0.05, **P < 0.01 (t-test) indicate a significant difference between mutants with the WT plants.

Figure S7. Venn Diagrams Showing the Overlaps between Transcripts Induced or Repressed (p value <0.05, 1.5-fold cutoff) by bzr1-1D under Permissive Temperature and Cold Stress with Transcripts Induced or Repressed by CBFs.

Figure S8. The Enrichment GO Terms in Figure 7B Genes.

Figure S9. ChIP and EMSA Assays of BZR1 Binding to the Promoters of PYL6, SOC1, JMT and SAG21 Genes. (A) Chromatin from 35S:BZR1-Myc seedlings were immunoprecipitated with anti-Myc antibody or without antibody, and the amounts of the indicated DNA in the immune complex were tested by qRT-PCR. A Tubulin2 fragment was amplified as a control. The Relative Enrichment calculated as Input% (indicated DNA)/Input% (control). The data are the mean values of three technical replicates ± SD from one experiment. At least three independent experiments were performed with similar results.(B) EMSA assay of BZR1 binding to the promoters of SOC1 and JMT genes. Biotin-labeled fragments representing parts of SOC1 and JMT were incubated with MBP or MBP-BZR1 protein. Competitor or mutated competitor fragments were added in 100 × or 300 × excess to analyze the specificity of binding.

Supplemental Table 1. Overlap genes of BZR1 targets with BES1 targets in plant response to cold stress.

Locus AnnotationAT1G01470 LEA14 (Embryogenesis abundant 14)AT1G09350 GolS3 (Galactinol synthase 3)AT1G19180 JAZ1 (Jassmonate-zim-domain protein 1)AT1G21910 DREB26 (Dehydration response element-binding protein 26)AT1G22190 OSH1 (Oas high accumulation 1)AT1G29390 COR314-TM2 (Cold regulated 314 thylakoid membrane 2)AT1G29395 COR413-TM1 (Cold regulated 314 thylakoid membrane 1)AT3G05640 Protein phosphatase 2C family proteinAT3G14440 NCED3 (Nine-cis-epoxycarotenoid 3)AT3G23050 IAA7 (Indole-3-acetic acid 7)AT3G48360 bt2 (Btb and taz domain protein 2)AT3G53420 PIP2A (Plasma membrane intrinsic protein)AT4G17615 CBL1 (Calcineurin B-like protein 1)AT4G25470 CBF2 (C-repeat/DRE binding factor 2)AT4G25490 CBF1 (C-repeat/DRE binding factor 1)AT4G27410 RD26 (Response to desiccation 26)AT5G04590 SIR (Sulfite reductase)AT5G20250 DIN10 (Dark inducible 10)AT5G58070 TIL (Temperature-induced lipocalin)

Supplemental Table 2. List of primer sequences used in this study.Primers for quantitative real-time PCR

Primer name Primer SequenceCBF1-FCBF1-RCBF2-FCBF2-RCBF3-FCBF3-RKIN1-FKIN1-R

AAGATCAAGACGAAGGATAGCATGAGATCGTCTCCTCCATGTCCAGTGACGTGTCCTTATGGAGCTACTGCACTCAAAAACATTTGCAGATGACGACGTATCGTTATGGATACACTCGTTTCTCAGTTTTACAAACTGGAGCTGGAGCACAACA GACCCGAATCGCTACTTGTTC

COR47-F CAGTGTCGGAGAGTGTGGTGCOR47-R ACAGCTGGTGAATCCTCTGCRD29A-F GCCGAGAAACTTCAGATTGGRD29A-RBIN2-FBIN2-RBZR1-FBZR1-RWRKY6-FWRKY6-RPYL6-FPYL6-RSOC1-FSOC1-RSAG21-FSAG21-RJMT-FJMT-RESM1-FESM1-R

CCATTCCTCCTCCTCCTTTCGAGATGCCTGCTGCTGTAGTTGCTTGGAAAACGATCCCGAAAATGGGAAGGCTCGTGGTTATGGAGAAGGCTTTGGGCAGCAACCACAACTCACTGATGCTGTGACTGAGAAAACGCTGCGAGCGGCTTGAGATCATGGAACACGTGTCCTCTTCTTGCCGGATCGAGTCAGCACCAAACAGCTGTTGCTCAATCTGTTGCCTGTTGCTTCGGCTGTGATGGCGTCAATCTCGTTGGAACCATGTCCATGGCCAAAGAGGGCGGAGCTCGCAGCATAGTAAGGGTGTTCCCAACGTAGCTTAATCAGCGATGAAGTCGGGG

ACTIN2/8-F GGTAACATTGTGCTCAGTGGTGGACTIN2/8-R AACGACCTTAATCTTCATGCTGC

Primers for constructs in plant transformationPrimer name Primer SequenceBIN2-OE-FBIN2-OE-R

GGGGTACCAGTTCCAGATTGATTCCCCCCGGGATGGCTGATGATAAGG

Primers for ChIP assaysPrimer name Primer SequenceCBF1-P1-FCBF1-P1-R

GTAACAACAGCAGCCAGCCAACACGGAGTTTTTGTCTCTGTGAAT

CBF1-P2-FCBF1-P2-RCBF1-P3-FCBF1-P3-RCBF2-P1-FCBF2-P1-RCBF2-P2-FCBF2-P2-RCBF1-C1-FCBF1-C1-RCBF1-C2-FCBF1-C2-RWRKY6-P1-FWRKY6-P1-RWRKY6-P2-FWRKY6-P2-RWRKY6-P3-FWRKY6-P3-RWRKY6-P4-FWRKY6-P4-RPYL6-P1-FPYL6-P1-RSAG21-P1-FSAG21-P1-RJMT-P1-FJMT-P1-RSOC1-P1-FSOC1-P1-RSOC1-P2-FSOC1-P2-RTUB2-FTUB2-R

ATTCACAGAGACAAAAACTCCGTGAAGTGAGAGTGAGAATTGGTGTACACCAATTCTCACTCTCACTTACGTAGTTACTAGAGTTCTCAGTCTAATACACCCCTGCCACTTGTTCACAAGTTGCTTAAAATCGAAGGATACAAAACCGTGGGATCGCTTCGAACGCGGAGTTTCTGTCCGTGTGATGATATGTTCGTGGCAGTAGTTGCTTTCAAGGCCGAAGGCCCAATACTCCTAAAAAGTTCTGAAGGACGAGAAGTCGAGTATTAGAAGCCGGGCCGTCAATCCACCGCTCCGTTTACTGATCCACCAAAAACGCATCCAAGGGGAGGACCGACCTTTGTCT AATCCCAAACGGTGTACTCTCTGGGTAACAGGTTGACGAAAAGGCGTCAACCTGTTACCCAATAGCGGGATTCTAAGCCCGTTTCAAAATCCCAAGTGGACAACCGATGGCTCTCTCTAAGAAAACAAATGGGGCCGAAACCACGAATCAAAAACTTGCGTGTACTAGCCGTGACTTTTGCGCGCGGATTAAAGCATCTTATGGACGTGCGTTGTCTTTAGTAATCCGAGGGACCAATGGGGCAATGGCGTTAAGTAACAAGTGGGGGCATATAGGTTAGTTGGATGGAAATGCCTGTCAATCCGTGAAGAGTACCCAGATAAGAACCATGCACTCATCAGC

Primers for transient transactivation assaysPrimer name Primer SequenceCBF1-Pro-FCBF1-Pro-RCBF2-Pro-FCBF2-Pro-RBZR1-MYC-FBZR1-MYC-RBES1-MYC-FBES1-MYC-R

CGGAATTCGGACGAGAAGTCGAGAACGGGATCCTGATCAGAGTACTCTGCGGAATTCATAGACCGTACACCATCGGGATCCTGATCAGAAGAGTACTCTGGCTCTAGAATGACTTCGGATGGAGCTGGGGTACCACCACGAGCCTTCCCAGACTAGTATGAAAAGATTCTTCTATAATAGGTACCACTATGAGCTTTACCATTT

Probes for EMSA assaysProbe name Probe SequenceCBF1-P1-FCBF1-P1-RCBF1-mP1-FCBF1-mP1-RCBF2-P2-FCBF2-P2-RCBF2-mP2-FCBF2-mP2-RWRKY6-P1-F(EMSA)WRKY6-P1-R(EMSA)mWRKY6-P1-F(EMSA)mWRKY6-P1-R(EMSA)JMT-F(ESMA)JMT-R(ESMA)mJMT-F(ESMA)mJMT-R(ESMA)SOC1-F(ESMA)SOC1-R(ESMA)mSOC1-F(ESMA)mSOC1-R(ESMA)BZR1-MBP-FBZR1-MBP-RBES1-MBP-FBES1-MBP-R

TGTACTATACACGTGTCATTCACATGTGAATGACACGTGTATAGTACATGTACTATAAAAAAATCATTCACATGTGAATGATTTTTTTATAGTACATTTCTTATCCACGTGGCATTCACATGTGAATGCCACGTGGATAAGAAATTTCTTATCAAAAAAGCATTCACATGTGAATGCTTTTTTGATAAGAAAAGGTATAATCACGTGGAACGCGCCGGCGCGTTCCACGTGATTATACCTAGGTATAATAAAAAAGAACGCGCCGGCGCGTTCTTTTTTATTATACCTATTAACTGCGTGTGGATACCGATCGGTATCCACACGCAGTTAATATTAACTGAAAAAAGATACCGATCGGTATCTTTTTTCAGTTAATATCAATTACAAGTGGGGGCATATATGCCCCCACTTGTAATTGATATCAATTAAAAAAAGGGGCATATATGCCCCTTTTTTTAATTGATAGAATTCATGACTTCGGATGGAGCTACGTGTCTAGAACCACGAGCCTTCCCATTTCCATGAATTCATGAAAAGATTCTTCTATAATTAGAATTCACTATGAGCTTTACCATTTC