+ => bioinformatics: from sequence to knowledge outline: introduction to bioinformatics the tau...

22
+ >= Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases: the use of genome browsers, identifying gene splicing, pseudogenes, mutation severity prediction, PCR utilities, other useful tools In brief: High-throughput technologies and experimental options 1 Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

Upload: stuart-owens

Post on 20-Jan-2016

230 views

Category:

Documents


3 download

TRANSCRIPT

Page 1: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

+

>=Bioinformatics: from Sequence to Knowledge

Outline:• Introduction to bioinformatics• The TAU Bioinformatics unit • Useful bioinformatics issues and databases: the use of genome browsers, identifying gene splicing, pseudogenes, mutation severity prediction, PCR utilities, other useful tools• In brief: High-throughput technologies and experimental options• The protein space1

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

Page 2: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

The biotechnology revolution creates high-throughput data

http://chagall.med.cornell.edu/BioinfoCourse/presentations2010/Lecture1_2010.pdf

Late 60’s, early 70’s 1980s 21st century

2Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

Page 3: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

The human genome project (HGP)

Francis Collins (chairman of the international project from the NIH): “I think this is probably the most important scientific effort that mankind has ever mounted. That includes splitting the atom and going to the moon”.

1990-2003: Aim: to reveal the blueprint of human biology (3,000,000,000 letters).

3Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

Page 4: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University4

The human genome project (HGP): sequencing strategies

Page 5: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University5

Genomes for everyone

2014

+>=

>=

Page 6: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

http://www.advances-in-genomics.org/presentations/Flicek.pdf

Huge amount of data

What do we do with all

this???

6Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

Page 7: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Goal: Make sense of bio-medical data using computer tools, and thereby bridge the gap between molecular biology and computer

science .

Data produced by Bio-Med labs &

stored in database

Analysis & better understanding

BioinformaticsBioinformaticsAlgorithmsAlgorithms and Toolsand Tools

Enables large scale analysis and interpretation of data. Provides computational methods for global understanding of biological data.

Why Bioinformatics?

7Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

Page 8: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University8

Bioinformatics topics are all linked together

Page 10: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Why use consultation when many databases and tools are free and easy-to-use ?

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

10

• Bioinformatics is a huge and dynamic field• New databases and tools are published every day, not all are good or even working, updates are crucial !• Choosing parameters for bioinformatics tools can be tricky and may change results dramatically !!!• Not always there ISIS a bioinformatics solution to every question, if not today, maybe tomorrow !

Page 11: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Rules of thumb !

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

• Use bioinformatics ! Google for new tools !

• It is best to use bioinformatics tools at the planning stage of experiment, and

not after performing it

• Make sure you use at least 2-3 different algorithms, with different

parameters, rely mainly on results that agree using different analyses

• Stick to mainstream databases and tools, as databases vary in content,

reliability, updates and handiness

• When you compare experiments, you are comparing the combination of the

experiment and the analysis, which may vary

•Do not hesitate to contact us if you have questions, as experience may save

you time and efforts11

Page 12: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Name Tel.Activity

Dr. Metsada Pasmanik-Chor

x 6992Genomics, DNA and proteins sequence analysis, microarray and Next Generation design and analysis

Adva Yeheskelx 6840Proteomics and structural biologyDr. Orly Yaron and Dr. Shira Modai

x 5251Microarray and next generation sequencing design and experiments (wet lab)

Bioinformatics students, projects

Collaborations in student projects on various subjects

Goals: bioinformatics teaching, scientific research and grant proposal collaborations

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

TAU Bioinformatics UnitWeb-page :http://www.tau.ac.il/lifesci/bioinformatics.html

12

Page 13: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University13

TAU Bioinformatics UnitWeb-page :http://www.tau.ac.il/lifesci/bioinformatics.html

Page 14: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University14

Sequence analysis: a multistep process

http://genome.cshlp.org/content/13/1/1.long

Homolog genes: derived from a common ancestral gene

Ortholog genes: rising from speciation

Paralog genes: duplication of a chromosomal segment

HomoloGene database:http://www.ncbi.nlm.nih.gov/homologene

Page 15: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Homologues and Sequence Conservation = Functionality

http://www.pgaeducation.org/tutoria/WUSTL/BerkeleyPGACompGeno_Boffelli.2.ppt#325,4,Slide

AGTTGAAACCTATAAATGCGTGATGGAGCGGTGGGATAGTTGAAACCTATAAATGCGTGATGGAGCGGTGGGAT

TACATTTCGACTATAAATGCGTATCGCCTCGCAACCCAATACATTTCGACTATAAATGCGTATCGCCTCGCAACCCAA

Conservationscale

sequence

AA

AA

diverged

CTATAAATGCGTCTATAAATGCGT

CTATAAATGCGTCTATAAATGCGT

conserved

80 m

illio

n ye

ars

potential functional region

Metsada Pasmanik-Chor, Ph.D. TAU Bioinformatics Unit

15

Page 16: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University16

http://www.ncbi.nlm.nih.gov/homologene/47906

Page 17: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University17

Working example: the human estrogen receptor alphaRefSeq Genes:

NM_001122742.1NM_001122741.1NM_001291230.1NM_001122740.1NM_000125.3

NM_001291230.1: [provided by RefSeq, Mar 2014].

Page 18: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

UCSC: http://genome-euro.ucsc.edu/index.html http://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg19&position=chr6%3A152128814-152424408&hgsid=197277749_7mr2oIF1falEKD09ZDOn6oa4DEl5

Splicingevents

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University18

The UCSC genome browser

Dec. 2013 (GRCh38/hg38) Assembly ?

Page 19: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

ESR1 [NM_001122742]chr6:152011631-152424408, strand +Genomic length: 412778 bps, 10 exons

Inetrgenic regionIntronic regionTransposons and repeatsCoding exons

http://ecrbrowser.dcode.org/ UTRUTR

* D538G

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University19

ECR Browser

Page 20: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University20

- An integrated database of human genes that includes automatically-mined genomic, proteomic and transcriptomic information, as well as orthologies, disease relationships, SNPs, gene expression, gene function, and service links for ordering assays and antibodies. A collection of useful information concerning all human genes.

http://www.genecards.org/cgi-bin/carddisp.pl?gene=ESR1&search=esr1

Page 21: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University21GeneAtlas: http://genatlas.medecine.univ-paris5.fr/fiche.php?symbol=ESR1

UCSC Genome Browser on Human Mar. 2006 (NCBI36/hg18)

Page 22: + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases:

Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University22

https://fenix.tecnico.ulisboa.pt/downloadFile/3779571263334/intro_bioinformatica_55.pdf

Today’s workshop