© 2014 sanju kunwar · grafting and systemic acquired resistance inducer for management of...
TRANSCRIPT
GRAFTING AND SYSTEMIC ACQUIRED RESISTANCE INDUCER FOR MANAGEMENT
OF BACTERIAL WILT DISEASE OF TOMATO
By
SANJU KUNWAR
A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
UNIVERSITY OF FLORIDA
2014
© 2014 Sanju Kunwar
To my family for their unconditional love, support and belief on me
4
ACKNOWLEDGMENTS
I would like to express my gratitude to my advisor Dr. Mathews L. Paret and my co-
advisor Dr. Jeffrey B. Jones for giving me the opportunity to pursue my master’s degree at
University of Florida. I would like to sincerely thank Dr. Paret and Dr. Jones for their constant
guidance and encouragement throughout my degree program. I would also like to thank my
committee member Dr. Joshua H. Freeman for his constant support and valuable suggestions
throughout my research especially during my thesis writing process.
My sincere appreciation to Laura Ritchie, biological scientist at North Florida Research
and Education Center (NFREC), who helped me significantly on my field trials. In addition, I am
also thankful to NFREC farm crew for helping me in my field trials. Further, I would like to
extend my special thanks to Yonas Kefialew for kindly helping me with statistical analysis of my
data, to Laura Fleites for her significant help on my gene expression studies and to Thu Nga
Nguyen for her kind help and suggestions. Thanks to Dr. David Francis for providing the seeds
of hybrids tomato rootstocks for my bacterial wilt screening work and to Dr. Dean Gabriel for
allowing me to work in his lab for my quantitative real time - PCR experiment.
My heartfelt appreciation to all the other wonderful people in Dr. Jones’ Lab in
Gainesville and in Dr. Paret’s lab in Quincy for their kind assistance and support during my
Master’s program. Thanks to Amanda Strayer for being so supportive and helpful. Also, I am
grateful to Dr. Stall and Jerry Minsavage for taking care of my plants in the greenhouse. Thanks
to NFREC staffs for their help and support, especially to Sheeja George for her valuable
suggestions and support. At last but not the least, thanks to my family and friends without which
this work would not have been possible.
5
TABLE OF CONTENTS
page
ACKNOWLEDGMENTS ...............................................................................................................4
LIST OF TABLES ...........................................................................................................................7
LIST OF FIGURES .........................................................................................................................8
ABSTRACT ...................................................................................................................................10
CHAPTER
1 LITERATURE REVIEW .......................................................................................................12
Introduction .............................................................................................................................12
Tomato: Botanical Description and History ....................................................................12 Tomato World Production Statistics ...............................................................................13
Production in the United States .......................................................................................13 Bacterial Wilt of Tomato ........................................................................................................15
History .............................................................................................................................15
Classification ...................................................................................................................15
Host Range and Geographical Distribution .....................................................................17 Symptoms ........................................................................................................................18 Epidemiology ..................................................................................................................19
Detection and Diagnosis ..................................................................................................21 Cultural Characteristics ...................................................................................................21
Serological and Molecular Assays ..................................................................................22 Management of Bacterial Wilt Disease in Tomato .................................................................22
Bacterial Wilt Resistance in Tomato ...............................................................................25
Grafting for Managing Soil-borne Diseases of Tomato Including Bacterial Wilt ..........26 Systemic Acquired Resistance (SAR) .............................................................................29
Acibenzolar-S-Methyl for Bacterial Wilt Management of Tomato ................................32
2 SCREENING OF BACTERIAL WILT RESISTANCE IN NEW HYBRID TOMATO
ROOTSTOCKS ......................................................................................................................35
Introduction .............................................................................................................................35
Materials and Methods ...........................................................................................................37 Bacterial Culture ..............................................................................................................37 Plant Material ..................................................................................................................37 Greenhouse Experiments .................................................................................................38 Statistical Analysis ..........................................................................................................39
Result ......................................................................................................................................39
Discussion ...............................................................................................................................41
6
3 EFFECT OF FOLIAR AND DRENCH APPLICATION OF ACIBENZOLAR-S-
METHYL ON THE INDUCTION OF DEFENSE GENES AGAINST BACTERIAL
WILT DISEASE OF TOMATO .............................................................................................49
Introduction .............................................................................................................................49
Materials and Methods ...........................................................................................................52 Bacterial Culture and Inoculum Preparation ...................................................................52 Greenhouse Experiments .................................................................................................52 Gene Expression Studies .................................................................................................53 Plant Materials and Treatment .........................................................................................54
Statistical Analysis ..........................................................................................................56
Results.....................................................................................................................................56
Greenhouse Experiments .................................................................................................56 ASM Mediated Effect on Expression of PR1a, PR1b and Pin II in Tomato Root and
Leaf ..............................................................................................................................57 Discussion ...............................................................................................................................58
4 INTEGRATING GRAFTING AND APPLICATION OF SYSTEMIC ACQUIRED
RESISTANCE INDUCER FOR FIELD MANAGEMENT OF BACTERIAL WILT
DISEASE OF TOMATO ........................................................................................................68
Introduction .............................................................................................................................68
Materials and Methods ...........................................................................................................71 Bacterial Culture and Inoculum Preparation ...................................................................71
Field Trials .......................................................................................................................71 Statistical Analysis ..........................................................................................................74
Results.....................................................................................................................................74
Discussion ...............................................................................................................................75
5 SUMMARY AND CONCLUSION .......................................................................................85
LIST OF REFERENCES ...............................................................................................................89
BIOGRAPHICAL SKETCH .......................................................................................................105
7
LIST OF TABLES
Table page
1-1 Total production, total area planted, total area harvested and farm value of the two
leading fresh market tomato producing states in the United States in 2013. .....................14
2-1 Mean percentage disease severity of 28 new tomato hybrid rootstocks inoculated
with 107 CFU/mL of Ralstonia solanacearum (Rs5) at 7, 14 and 21 days post
inoculation..........................................................................................................................45
3-1 Bacterial wilt disease severity (DS) (%) of susceptible cultivar ‘BHN 602’ and
resistant rootstock ‘BHN 998’ in the greenhouse following foliar and drench
applications of Acibenzolar-S-Methyl (ASM)...................................................................62
4-1 Fruit yield (kg/ha) and percentage bacterial wilt (BW) incidence of tomato cultivar
‘BHN 602’ grafted onto resistant rootstock ‘BHN 998’ integrated with foliar
application of ASM (0.5 oz/A). .........................................................................................79
4-2 Fruit yield (kg/ha) and percentage bacterial wilt (BW) incidence of tomato cultivar
‘BHN 602’ grafted onto resistant rootstock ‘BHN 998’ integrated with foliar and
drip application of ASM (0.5 oz/A). ..................................................................................80
4-3 Percentage bacterial wilt (BW) incidence of tomato cultivar ‘BHN 602’ grafted onto
resistant rootstock ‘BHN 998’ integrated with foliar and drip application of ASM
(0.5 oz/A). ..........................................................................................................................81
8
LIST OF FIGURES
Figure page
1-1 Symptoms of bacterial wilt disease in tomato plant infected with Ralstonia
solanacearum (race 1, biovar .............................................................................................34
1-2 Pure culture of Ralstonia solanacearum in A) CPG media and B) modified SMSA
media. .................................................................................................................................34
2-1 Percentage disease severity of the 28 new tomato hybrid tomato rootstocks
inoculated with 107 CFU/mL of R. solanacearum (Rs5). ..................................................46
2-2 The hybrid rootstocks along with resistant and susceptible control at 21 days post
inoculation with R. solanacearum (Rs5) suspension adjusted to 107 CFU/mL .................47
2-3 Bacterial population in the collar region of the bacterial wilt resistant BHN 998 &
H7997 and in resistant hybrid tomato rootstocks (WG12-110, WG12-120 & WG12-
140) at 21 days post inoculation with R. solanacearum suspension adjusted to 107
CFU/mL. ............................................................................................................................48
3-1 Reduction of bacterial wilt disease symptoms in drench ASM treated susceptible
tomato cultivar (BHN 602) compared to foliar treated and untreated control
following inoculation with 107
CFU/mL of R. solanacearum with root wounding. .........63
3-2 Reduction of bacterial wilt disease symptom in drench ASM treated resistant
rootstock (BHN 998) compared to untreated control, following inoculation with 107
CFU/mL of R. solanacearum with root wounding. ...........................................................64
3-3 Mean fold induction of PR1a in the leaf and root tissues of bacterial wilt susceptible
cultivar (BHN 602) at 24, 48 and 72 hours post ASM application relative to the
corresponding water treated controls.. ...............................................................................65
3-4 Mean fold induction of PR1b in the leaf and root tissues of bacterial wilt susceptible
cultivar (BHN 602) at 24, 48 and 72 hours post ASM application relative to the
corresponding water treated controls. ................................................................................66
3-5 Mean fold induction of Pin II in the leaf and root tissues of bacterial wilt susceptible
cultivar (BHN 602) at 24, 48 and 72 hours post ASM application relative to the
corresponding water treated controls. ................................................................................67
4-1 Progression of bacterial wilt incidence of tomato cultivar ‘BHN 602’ grafted onto
resistant rootstock ‘BHN 998’ integrated with foliar application of ASM (0.5 oz/A). .....82
4-2 Progression of bacterial wilt incidence of tomato cultivar ‘BHN 602’ grafted onto
resistant rootstock ‘BHN 998’ integrated with foliar and drip application of ASM
(0.5 oz/A). ..........................................................................................................................83
9
4-3 Progression of bacterial wilt incidence of tomato cultivar ‘BHN 602’ grafted onto
resistant rootstock ‘BHN 998’ integrated with foliar and drip application of ASM
(0.5 oz/A). ..........................................................................................................................84
10
Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science
GRAFTING AND SYSTEMIC ACQUIRED RESISTANCE INDUCER FOR MANAGEMENT
OF BACTERIAL WILT DISEASE OF TOMATO
By
Sanju Kunwar
December 2014
Chair: Mathews L. Paret
Major: Plant Pathology
Greenhouse trials and field studies were conducted in Florida from 2012-2014 to
determine the integrated effect of grafting and application of Acibenzolar-S-Methyl (ASM), an
inducer of systemic acquired resistance (SAR), for controlling bacterial wilt disease of tomato,
caused by Ralstonia solanacearum (R. solanacearum). In the greenhouse, two drench
applications of ASM (50 mg/l), followed by inoculation with a bacterial suspension of R.
solanacearum adjusted to 107
CFU/mL, significantly reduced bacterial wilt disease in a
susceptible tomato cultivar (BHN 602) as compared to foliar treated or untreated control
(P=0.05). In the field, a single drench application of ASM (50 mg/l) before transplanting
followed by weekly drip applications (0.5 oz/A) after transplanting also reduced bacterial wilt
incidence in BHN 602 in both the field trials, with one of them being statistically significant to
the untreated control (P=0.0045). However, no substantial effect on yield was evident in BHN
602 with the drip ASM treatment (P=0.0057). Grafting (BHN 998 rootstock and BHN 602
scion), alone or in combination with drip ASM treatment (0.5 oz/A), provided significantly better
disease control and yield relative to the untreated control. In contrast, foliar ASM application
combined with grafting provided a marginal (statistically non-significant but numerically
11
consistent) increase in disease incidence and statistically reduced yield in one of the field trials as
compared to the untreated grafted control (P<0.0001). Grafting alone and grafting combined with
drip ASM treatment did not differ statistically in controlling the disease and improving yield.
12
CHAPTER 1
LITERATURE REVIEW
Introduction
Tomato: Botanical Description and History
Tomato (Solanum lycopersicum) belongs to Solanaceae family, also known as nightshade
family, which is one of the most diverse and economically important botanical families (Heiser
1969; Rick 1976). Until the 1800s tomatoes were believed to be poisonous and were used just for
decoration purposes only (Jones 1991; Smith 1994). Tomato is believed to have its center of
origin in western South America in the mountainous region of the Andes in Peru, Chile and
Ecuador (Jones 1991; Peralta and Spooner 2000; Taylor 1986). The cultivation and
domestication of tomato outside the Andes is presumed to have taken place during early
civilizations of Mexico (Jones 1991). The name ‘tomato’ is believed to be derived from Nahuatl
language of Mexico. In Italy, tomato is also known as “love apple” (Jones 1991). C.M Rick
studied the evolution, taxonomy, distribution and ecological adaptation of tomatoes and its close
relatives resulting in a better understanding of the cultivated tomatoes (Rick 1973; Rick et al.
1975; Rick 1976; Rick 1978). Cultivated tomatoes are usually diploid (2x=2n=24), tender and
self-pollinating herbaceous perennials with an optimum growth temperature of 21-23°C (70-
75°F) (Jones 1991; Tanksley 1987). The tomato fruit consists of 94-95% water and the
remaining 5-6% comprises a complex organic mixture, which basically contributes to the typical
tomato flavor. Nutritionally, tomato is a good source of Vitamin A, Vitamin C, phytochemicals
such as carotenoids and polyphenols, and of dietary lycopene an important antioxidant (Lima et
al. 2005; Oliveira et al. 2013).
In the United States, history of commercial tomato production dates back to 1870.
Manatee County in the west central Florida is believed to be the first major tomato production
13
area in United States. Today, Florida contributes 36.64% of the total U.S fresh market tomato
production (USDA- NASS 2014)
Tomato World Production Statistics
Tomato is one of the important vegetable crops worldwide. According to the most recent
data by Food and Agriculture Organization (FAO) of the United Nations (UN), the world tomato
production (production quantity) in 2012 was 161,793,834 tonnes harvested from 4,803,680
hectares of land, and had a farm value of $59.11 billion (FAOSTAT Database, 2012). Among
170 countries reported for producing tomatoes in 2012, the two leading producers - China and
India had total tomato production of 50,125,055 and 17,500,000 tonnes respectively harvested
from 1,005,003 and 870,000 hectares of land (FAOSTAT Database 2012). With total production
of 13,206,950 tonnes harvested from 150,140 hectares, the United States was the third largest
producer of tomato in the world and had a farm value of $4.88 billion in 2012 (FAOSTAT
Database 2012).
Production in the United States
Florida and California are the two leading states in U.S. fresh market tomato production
(USDA- NASS, 2014). In 2011 and 2012, Florida contributed 32.30% and 35.31% of total U.S.
fresh market tomato production and had the highest farm gate values of $435.02 million in 2011
and $267.96 million in 2012 (USDA- NASS 2014). California contributed 40.24% and 36.03%
of total U.S. fresh market tomato production in 2011 and 2012, respectively, and had the second
largest farm gate values of $259.01 and $221.67 million in 2011 and 2012, respectively. (USDA-
NASS, 2014). California is the leading producer of processed tomato products in U.S. and
worldwide (USDA-ERS 2012; USDA National Agriculture Statistics Service - USDA 2013).
The most recent data on the fresh market tomato production in Florida and California is
presented in Table 1-1.
14
Table 1-1. Total production, total area planted, total area harvested and farm value of the two
leading fresh market tomato producing states in the United States in 2013.
U.S fresh-market tomato production U.S. Total California Florida
Area planted (acres) 97,300 28,500 35,000
Area harvested (acres) 93,600 28,000 34,000
Production (tonnes) 1,249,280 426,739 457,729
Farm value (billion$) 1.11 0.30 0.46 (Source: USDA- NASS March 2014)
In the United States, four types of tomato cultivars are mainly grown. These include i.
Large fruited and beefstake types: (BHN 602, Tasti-Lee, Crista, FL47, Quincy etc.) ii. Plum type
varieties: (BHN 685, Marianna etc.) iii. Cherry type varieties: (Shiren, BHN 268 etc.) and iv.
Grape tomatoes (Cupid, Santa etc.) (Bielinski et al. 2014). Per capita consumption of fresh
market tomato fruit in U.S increased from 14.9 lb in 1985 to 17.8 lb in 2000 (ERS-USDA 2000).
More recently, tomato was ranked as the fourth most popular fresh-market vegetable next to
potato, lettuce and onions (ERS-USDA 2012). The continued increase per capita consumption of
tomato can be attributed to the enduring popularity of tomato containing food and the
considerable health benefits of eating tomatoes (Lima et al. 2005; Oliveira et al. 2013).
Open field tomato production in the southeastern United States, including Florida, is
highly affected by bacterial wilt disease caused by Ralstonia solanacearum (R. solanacearum)
(Hong et al. 2012; Ji et al. 2005). R. solanacearum is a soil-borne bacterium belonging to β
subdivision of Proteobacteria. Major crop losses due to the disease have been reported from
almost all of the tomato producing regions of the world (Hayward 1991; Hayward 1994). Apart
from bacterial wilt of tomato, R. solanacearum is known to cause bacterial wilt of ginger
(Zingiber officinale R.), moko disease of banana (Musa sp. L.), southern bacterial wilt of
geranium (Pelargonium hortorum L.H. Bailey), Granville wilt of tobacco (Nicotiana tobacum
L.), bugtok disease on plantains (Musa paradisiaca) and brown rot of potato (Solanum
15
tuberosum L.). Currently, the bacterium has been listed as the second most important bacterial
pathogen in the world (Mansfield et al. 2012).
Bacterial Wilt of Tomato
History
Bacterial wilt disease was first reported in tomato, tobacco, groundnut and potato during
the late 19th century in Asia, South America and southern regions of the United States
(OEPP/EPPO Bulletin. 2004). In the United States, history of bacterial wilt in tomato dates back
to 1897, when P. H. Rolfs first described the disease in tomato fields in 1897 (Rolfs 1898). Crop
losses varying from a few plants to as much as 90% were reported from the infected tomato
fields. The causal agent, R. solanacearum, was first identified in tomato by Erwin F. Smith in
Mississippi, U.S. in 1896 (Kelman 1953; Smith et al. 1896). Although first identified as Bacillus
solanacearum (Smith et al. 1896), it was later designated to the genus Pseudomonas in 1914
(Yabuuchi et al. 1995). Based on rRNA homology, the bacterium was reclassified in 1992 and
transferred to Burkholderia solanacearum (Yabuuchi et al. 1992). A few years later, based on
16S ribosomal RNA (rRNA), fatty acid analysis, rRNA-DNA hybridization and other phenotypic
differences, the bacterium was transferred to the genus Ralstonia (Yabuuchi et al. 1995).
Although strains within R. solanacearum have some traits in common, considerable variation
exists between them in terms of host range, carbohydrate utilization and optimal temperature
requirements for producing disease symptoms (Hong et al. 2012).
Classification
In the past, R. solanacearum was classified into five races based on the host range
(Buddenhagen. et al. 1962; EPPO Bulletin, 2004; He et al. 1983; Pegg et al. 1971). Race 1 is
predominantly found in tropical areas all over the world and has a wide host range covering
plants in many plant families, but predominantly within Solanaceae family. Race 2 is found in
16
the tropical areas of South America and has also been reported in the Philippines. This race
mainly attacks banana, heliconias and other Musa spp. Race 3, having worldwide distribution
except the U.S. and Canada, affects some of the economically important vegetable s like potato,
tomato, and capsicum and also occasionally solanaceous weeds (Solanum nigrum, S.
dulcamara). Many non-solanaceous host and ornamentals like geranium (Pelargonium zonale)
has also been reported to be the host of race 3 (Janse et al. 2004; Pradhanang et al. 2000;
Weneenker et al. 1999). Race 4, particularly affecting ginger is found in Asia (China, India,
Malaysia, Indonesia, the Philippines, Japan, Mauritius) and the U.S. (Hawaii) (Paret et al. 2008)
and race 5, mostly aggressive on mulberry, is found in China. Race 1, 3, and 4 are all considered
pathogenic on tomato but race 1 is the most prevalent one found in the southeastern U.S. (Genin
and Boucher 2002; Vallad et al. 2004; Hong et al. 2012; Kelman 1953). While race 1, 2, 4 and 5
have high temperature tolerance (35°C), race 3 (biovar 2) is cold tolerant (temperature optimum
of 27° C) and presents a serious threat to the U.S potato industry in temperate regions
(Elphinstone 2005). Therefore, race 3 biovar 2 has been subjected to strict quarantine restrictions
in the U.S. and was listed as a Select Agent on the Agriculture Bioterrorism Act of 2002
(Champoiseau et al. 2008; Gabriel et al. 2006). Depending on the ability to utilize/oxidize
disaccharides and hexose alcohols (maltose, lactose, cellobiose, mannitol, sorbitol and dulcitol),
the bacterium was primarily classified into four biovars (Hayward 1964). Later, with addition of
two more biochemical tests to the above list (trehalose utilization and production of gas from
nitrate), 5 biovars of R. solanacearum were defined (Hayward, 1991; Hayward, 1994). A tropical
variant of biovar 2 was identified as the sixth biovar (Fegan and Prior 2005; Hayward et al.
1992). Although the classifications based on races and biovars do not consistently correspond to
each other; biovar 2 strains most often belong to race 3 (Alvarez et al. 2005). Classification
17
based on race and biovar was not able to predict large variation existing in some groups (race 1).
So, based on the phylogenetic analysis of the sequences of ITS region, hrp B gene and
endoglucanase gene, the strains within R. solanacearum were further divided at subspecies level
into four phylotypes (identified by multiplex PCR based on ITS region) (Fegan and Prior 2005).
Apart from revealing the phylogenetic relationship, phylotype also reflected the geographical
origin of the strains. Phylotype I and II had its origin in Asia and America respectively (Cook et
al. 1989). The strains in phylotype III had African origin (Poussier et al. 2000) and Phylotype IV,
being the most recent to be classified, had its origin in Indonesia (Champoiseau et al. 2009).
Along with the Indonesian strains, phylotype IV hosted two other closely related species, i. R.
sygyzii (causal agent of Sumatra disease of clove that shares high DNA homology with R.
solanacearum but is non flagellate) and ii. Banana blood disease bacterium (BDB; genetically
close to R. solanacearum but differ in morphological and biochemical properties). Both R.
sygyzii and BDB have been reported to produce a specific band with R. solanacearum specific
primers 759/760 (Opina et al. 1997). The phylotypes within R. solanacearum have been further
subdivided into sequevars, at infrasubspecies level, which was further divided into clonal lines
(Fegan et al. 2004, Fegan and Prior 2005). Sequevar consists of a group of strains with <1%
divergence in endoglucanase (egl) or mutS gene sequences and clones consists of a group of
strains showing the same genomic fingerprint based on techniques like repetitive sequence based
PCR (BOX, ERIC, REP), random amplified polymorphic dna (RAPD), amplified fragment
length polymorphism (AFLP), pulsed gel field electrophoresis (PGFE) (Fegan and Prior 2005).
Currently, 51 sequevars of R. solanacearum have been identified (Xu et al. 2009).
Host Range and Geographical Distribution
Throughout the early 1900s, the bacterial wilt disease was reported to occur on tomato,
potato, tobacco, cucumber, peanut, bean, pepper, banana, ginger, geranium, mulberry, plantain,
18
cantaloupes and many other weed hosts from tropical, subtropical and temperate regions around
the world (Janse et al. 2004; Kelman 1953; Pradhanang et al. 2000; Weneenker et al. 1999;
Yabuuchi et al. 1992). The predominant strain found in North America falls within biovar I of
phylotype II, mainly affecting tomato and tobacco in the southeastern U.S. (Ji et al. 2005). In
Florida, race I (biovar I, phylotype II) has been reported to cause more than 80% yield loss in
tomato under disease favorable conditions (Hong et al. 2012). However, disease severity varies
according to the geographical regions, temperature, soil characteristics and cropping practices
(Thoquet et al. 1996). Hayward et al (1991) reported an expanded host range of more than 450
plant species in 54 families that includes many species within solanaceae and leguminoseae
families, some monocotyledons, several shrubs and trees and even the model host Arabidopsis
thaliana (Genin and Boucher 2002; Hayward 1994; Kelman 1953; Vallad et al. 2004).
Symptoms
Wilting is the most common symptom associated with bacterial wilt disease (Figure 1-1
A). It has been reported that if the environmental conditions are favorable, rapid and complete
wilting of the plants can occur within 2-3 days following initial symptoms (McCarter 1991). The
wilted leaves usually maintain their green color and do not fall off quickly. In tomatoes, the
youngest leaves are the first to be affected and usually have flaccid appearance. The wilting
symptom is more prominent in the warmest time of the day and may seem to recover during
early morning or at night, when the temperature is lower. In the field, the infected plants often
show stunted symptoms (Figure 1-1 A) and visually healthy plants may wilt suddenly especially
when fruits are expanding rapidly thereby causing a great yield loss (EPPO Bulletin, 2004;
Vallad et al. 2004; Champoiseau et al. 2009). Disease severity, however, depends on the
temperature, aggressiveness of the strain and host genotype. Appearance of adventitious roots in
the infected stem is also sometimes visible, especially when the disease conditions are not
19
favorable, for example low bacterial virulence, low temperature and resistant host genotype (Liu
et al. 2005; McCarter 1991) (Figure 1-1 C). Adventitious root formation in tomato stem can also
occur at high humidity and during stress. The vascular dysfunction mostly produces dark brown
discoloration of the infected stem (Figure 1-1 B). When the infected stem is cut longitudinally
and placed in clear water, streaming of a white viscous liquid containing bacterial cells can be
observed in the water oozing out from the vascular bundles (Champoiseau et al. 2009). Vascular
discoloration and the ooze test are generally used in preliminary disease diagnosis. Underground
symptoms associated with bacterial wilt may include root decay, whose intensities vary
according to the disease development stage (McCarter 1991).
Epidemiology
R. solanacearum is a soil borne pathogen. It enters into the host through wounds in the
roots and through secondary root emergence sites and invades the parenchyma cells in the pith
and cortex finally reaching the xylem vessels. During colonization of the inner cortex and xylem
vessels, the pathogen multiplies rapidly with the density reaching as high as 1010
CFU/g fresh
weight or more and spreads throughout the vascular system of the infected plant (Denny 2000;
Vasse et al. 1995; Xiao et al. 1983). In some cases, masses of bacterial growth are form near the
vascular bundles (Denny 2006; McCarter 1991; Vallad et al. 2004). A high molecular weight
exopolysaccharide (EPS) and multiple extracellular proteins (EXPs) are produced during the
systemic colonization of the host (Denny 2006). The copious amount of EPS occludes the xylem
vessels leading to the complete wilting of the infected plant (Denny 2000; Kelman 1953). The
EXPs are mostly the components of type II general secretary pathway and include the enzymes
required to invade plant cell wall (Denny 2000; Vasse et al. 1995). Other EXPs, which are
delivered to the plant cells via bacterial type III secretion system, plays important roles in
20
eliciting host defense and/or causing wilt symptoms. From the infected roots and decaying plant
material, bacterium is eventually released back to the soil.
Both short and long distance dispersal of R. solanacearum have been reported to occur on
infected propagative materials (Buddenhagen et al. 1964). This is especially true for
vegetatively-propagated crops like potato, ginger and banana. Apart from the propagative
material, R. solanacearum exhibits ability to survive extended periods in water (Kelman 1956;
Van Elsas et al. 2001; Wakimoto et al. 1982). Contaminated irrigation water was reported to
cause major disease outbreaks in a number of crops worldwide including the U.S. and Europe
(Álvarez et al. 2008 ; Elphinstone et al. 1996; Elphinstone et al. 1998; Faraq et al. 1999 and
Hong et al. 2008). In North Florida, Hong et al. (2005) reported the occurrence of the R.
solanacearum in irrigation ponds and in aquatic weeds; Pennsylvania smart weed (Polygonum
pennsylvanicum) and dollar weed (Hydrocotyle ranunculoides). Environmental factors like
temperature and pH of the water and presence of antagonists affect the bacterial survival in water
(Wakimoto et al. 1982). Although most available studies suggest that R. solanacearum survives
short in soil away from the infected plants (Graham and Lloyd, 1979), long-term survival is
believed to reflect the pathogen’s ability to latently infect the roots of non-host and colonize the
rhizosphere of non-hosts (Akiew and Trevorrow 1994; Graham et al. 1979; Granada et al. 1983).
Van Elsas et al. (2000) reported R. solanacearum (biovar 2) to persist in the soil in natural
condition for a period of 12 months or longer. Usually, a soil temperature of 30°C to 37°C favors
pathogen survival. Apart from soil temperature, other soil characteristics that can affect pathogen
survival are soil depth, soil type, moisture content, pH, availability of organic matter and
presence of the antagonists (Nesmith et al. 1983; Nesmith et al 1985; Verma and Shekhawat,
1991; Van Elsas et al. 2000). Ability of the bacterium to attain viable but non-culturable state
21
(VBNC) at low nutrient condition has also been well documented (Van Elsas et al. 2000). It is
believed that VBNC state is associated with the long- term survival of the pathogen in soil and
water and also in different stages of plant infection (Grey and Steak 2001). In addition to the
infested soil and contaminated water source, some other sources of bacterial inoculum include
stakes, farming equipment, and contaminated shoes of operators (Champoiseau et al. 2009; Hong
et al. 2008).
Detection and Diagnosis
R. solanacearum is non-capsulated, non-sporing, strictly aerobic, gram- negative, motile
rods (straight or slightly curved) with one to several polar flagella and have size of 0.5-0.7 x 1.5-
2.0 µm (Champoiseau 2008). It is oxidase positive, arginine dihydrolase negative and
accumulates poly- β- hydroxybutyrate (Denny 2006). The bacterium multiplies rapidly and
readily in its host as compared to its slow growth in vitro (Lelliott and Stead 1987). In various
growth media, the bacterium exhibits typical culture characteristics, that are widely used in
identification and detection.
Cultural Characteristics
Casamino acid: Peptone: Glucose (CPG) (Figure 1-2 A) and triphenyl tetrazolium
chloride (TTC/TZC) (Kelman 1994) are the most commonly used non-selective media for
culturing R. solanacearum (Marco-Noales et al. 2008; Sullivan et al. 2013). The colony
morphology in the solid media helps differentiate virulent type (irregularly-round, opaque and
fluidal, white or cream colored) from the non- virulent type (uniformly round, smaller and
butyrous/dry) (Champoiseau 2008). The oxygen stress condition causes a virulent type to
become non-virulent. The virulent colonies in the TZC media usually appear white with pink
centers and non-virulent colonies appear dark red (Champoiseau 2008). SMSA media, as
modified by Elphinstone et al. (1996) is widely used semi-selective media available for isolating
22
the bacterium from contaminated soil, contaminated water and latently infected plant samples
(Elphinstone et al. 1998; Wenneker et al. 1999) (Figure 1-2 B). Two percent sucrose peptone
agar (SPA) medium is also useful for culturing R. solanacearum in which it produces white
fluidal colonies with characteristic whorls (French et al. 1995). With an optimal growth
temperature ranging from 28- 32°C for most strains (except race 3 biovar 2 for which optimum
temperature is 27°C), R. solanacearum exhibits high sensitivity to desiccation and therefore is
often inhibited by low concentration of salt (2% NaCl). In contrast to many other plant
pathogens, R. solanacearum is viable for several years at room temperature in distilled or
deionized water (Champoiseau 2008); therefore, sterile deionized water is often used for long
term storage of the bacterium in laboratories (Champoiseau 2008).
Serological and Molecular Assays
Enzyme linked immunosorbent assay (ELISA), immunofluorescence (IF) and flow
cytometry are some of the most widely used serological methods available for detecting R.
solanacearum (Seal 1998; Alvarez 2005; van der Wolf et al. 2000). Immunostrips® (Agdia,
Elkhart, IN) are also used for rapid diagnosis of R. solanacearum. For specific characterization
and detection purposes, many sets of PCR primers have also been designed in the past (Fegan
and Prior 2005; Opina et al. 1997; Pastrik and Maiss 2000). Methods like Fatty acid methyl ester
analysis (FAME) and BIOLOG are also available for confirming R. solanacearum (Li and
Hayward 1993; MIDI 2001).
Management of Bacterial Wilt Disease in Tomato
In regions where the disease is endemic, cultural control methods are often recommended
(Saddler et al. 2005). The cultural control practices encompass simple inputs readily accepted by
farmers, like intercropping, deep plowing, use of pathogen free seedlings, elimination of weed
host and volunteers in and around the field, aquatic weed control, control of nematode
23
population, proper soil drainage, irrigation management and crop rotation (Champoiseau et al.
2009; Pradhanang et al. 2005; Vallad et al. 2004). Crop rotation using maize (Zea mays), okra
(Abelomoschus esculentum) and cowpea (Vigna unguiculata) were reported to reduce disease
severity by 20-26 % (Adhikari and Basnyat 1998). Assessment of the bacterial population in the
soil used for growing tomato indicated that greater than two non-host gives better reduction of
the disease incidence (Abdullah et al. 1992). Crop rotation is particularly effective against races
that exhibit narrow host range like race 3 on potato, but for races that exhibit wider host range
like race 1, the effect of crop rotation is minimal (McCarter. 1991). This is particularly true for
Florida as race 1 is endemic. In the past, rye (for winter) and sorghum-sudan (for summer) were
recommended, as a suitable rotation and cover crops for managing race 1 in North Florida
(Momol et al. 2005). As weed host range of R. solanacearum is extensive (Janse et al. 2004;
Pradhanang et al. 2000; Wenneker et al. 1999), proper and timely weed control is equally
important for successful disease management. In North Florida, growing tomatoes during cooler
months (spring season) has also been recommended to manage race 1 (Momol et al. 2005).
Soil fumigation with general purpose fumigants such as methyl bromide and/or
chloropicrin were commonly used for managing many of the soil-borne diseases including R.
solanacearum, root-knot nematodes and weeds (Denny 2006; Ishii and Aragaki 1963; Ji et al.
2005; Santos et al. 2006; Thoquet et al. 1996). Methyl bromide is a broad-spectrum biocide that
is injected into the soil as a liquid. Once in soil it subsequently vaporizes filling soil air space.
However, since the establishment of Montreal Protocol (UNEP 2011), methyl bromide has been
phased out, because of its ozone depleting activity (Santos et al. 2006). Field application rates
have been reduced and now methyl bromide use is only allowed under critical use exemptions
(King et al. 2008). In addition, Chloropicrin is under strict regulation of the United States
24
Environmental Protection Agency (EPA) (Gan et al. 2000). Thus the phase out of methyl
bromide, lengthy plant-back period and narrower pest management spectrum of other alternative
fumigants prompted researchers to find more feasible and eco-friendly management practices.
Few of the plant derived volatile essential oils like thymol (obtained from Thyme (Thymus
spp.)), palmarosa (obtained from Cymbopogan martini), and lemon grass oils were found
effective against Rs5 (race 1, biovar 1) in greenhouse grown tomatoes (Pradhanang et al. 2005).
Further, these essential oils were also found to significantly reduce R. solanacearum population
in the soil. In field experiments, thymol and palmarosa oil, when applied as pre-plant treatment
of the soil significantly reduced bacterial wilt incidence in tomatoes against Rs5 (race 1 biovar 1)
and significantly improved yield compared to untreated susceptible control (Ji et al. 2005).
Despite giving satisfactory disease control in the field, thymol and plamarosa oil are still not
preferred by growers because of their volatile nature, low soil retention, difficult field application
method and high cost. Other chemical control methods like acidified nutrient solution (Yi et al.
1998) and bleaching powder (Dhital et al. 1997) have further been suggested for controlling
bacterial wilt disease but are also not preferred because of the environmental concerns associated
with these chemicals. An integrated approach combining application of Systemic Acquired
Resistance inducers like Acibenzolar-S-Methyl (ASM; Syngenta Crop Protection
Inc.Greensboro, NC) with plant growth promoting rhizobacteria (PGPR) has also been suggested
(Anith et al. 2004). However, the unpredictable and unstable nature of PGPRs in the soil
environment prevents the commercial implementation of this combination in integrated pest
management (IPM) strategy (Champoiseau et al. 2009).
So far, use of the resistant cultivars has been universally identified as the most effective
and practical method for managing bacterial wilt disease (Boshou et al. 2005). Consequently,
25
resistance breeding against bacterial wilt disease has been one of the main focus areas in many
solanaceous crops, especially in tomato (Boshou et al. 2005; Lebeau et al. 2011).
Bacterial Wilt Resistance in Tomato
In the past, many bacterial wilt resistance sources have been identified and studied
extensively (Hanson et al. 1996; Jaworski et al. 1987). Most of the currently available bacterial
wilt resistant cultivars have their resistance derived from one of the three major resistance
sources i. PI127805 A (L. pimpinellifolium), a small-fruited tomato species (Gilbert et al. 1973).
H7996, H7997 and H7998, all highly resistance to bacterial wilt, were derived from PI127805 A
ii. CRA 66 (L. esculentum var. cerasiforme), another small-fruited tomato species. Caravel and
Caraibo were derived from CRA66 (Prior et al. 1994). iii. Beltsville #3814 and PI129080 A (L.
pimpinellifolium), the donors of the bacterial wilt resistance in Venus and Saturn (Henderson et
al. 1972). The number and types of the genes imparting bacterial wilt resistance in these
resistant sources however are different. In H7996 (Grimault et al. 1995) and H7998 (Scott et al.
1993), a single dominant gene was reported to give resistance against bacterial wilt. In CRA 66,
resistance against bacterial wilt was reported to be polygenic (Prior et al. 1994). Some of the
other reported resistance mechanisms in tomatoes include partial dominance (Acosta et al. 1964),
monogenic partial dominance (Rajan and Peter, 1986), multiple recessive genes (Tikoo et al.
1983), semi-dominant gene (Anais, 1968) and additive gene action (Villareal et al. 1978). The
multifaceted genetic control of resistance against bacterial wilt is further complicated by the
strong interaction between the host genotype and environmental factors (Arnold and Brown,
1986), making it nearly impossible to develop universal resistance to bacterial wilt (Genin and
Boucher, 2002). A worldwide evaluation of 35 resistance sources of tomato in 11 countries
demonstrated that resistance against bacterial wilt is location specific (Wang et al. 1998). Some
of the other major factors hindering successful development of bacterial wilt resistant tomato
26
cultivars includes i. quantitative inheritance pattern of the resistance (Acosta et al. 1964; Hanson
et al. 1998) ii. negative correlation between resistance and fruit qualities iii. resistance break
down at high temperature and iv. differences in the aggressiveness of the bacterial strains at
difference locations. For example, the use and effectiveness of the commercially available
bacterial wilt resistant tomato cultivars, FL7514, is limited only to certain geographic locations
(McCarter 1991; Vallad et al. 2004) and although large fruited varieties with high levels of
resistance against bacterial wilt are available, for example, Fla. 8109 (having resistance similar to
H7997), there are only few of those varieties available (Scott et al. 2009).
All of the above aspects including limited availability of stable resistance source, loss of
methyl bromide, cost effectiveness and environmental concerns of chemical control and
constraints in using alternative fumigants together have generated interest in tomato producers to
seek more effective, environmentally friendly alternatives to manage bacterial wilt disease in
tomato.
Grafting for Managing Soil-borne Diseases of Tomato Including Bacterial Wilt
The history of grafting in fruits and vegetables dates back to 1920’s and 1930’s when it
was primarily used to protect watermelon against Fusarium wilt (Murata and Ohara, 1936).
Known to have a long history in Asia, grafting is still widely practiced in many countries there to
manage multiple soil-borne diseases. For instance, in Korea and Japan alone, grafted plants
accounted for 81% and 54% of the total vegetable acreage, respectively (Lee, 2003). More
recently, the practice of grafting has been rapidly expanding in many parts of the world including
North America, Central America and Middle East. Plants in the cucurbitaceae family
(watermelon and cucumber) (Lee et al. 2003; Oda 2007) and solanaceae family (eggplant and
tomato) (King et al, 2008; Lee et al. 2010; Oda 1999) are being adopted for grafting. In
tomatoes, the practice of grafting was extended into commercial production system in many parts
27
of the world in the early 1960’s to control soil-borne diseases (Harrison and Brugess, 1962;
Smith 1966; Smith 1968). In Europe, grafting not only was a popular practice to control root
diseases in soil but was also used to control root diseases in hydroponic systems (Oda, 2002).
Majority of hydroponics based tomato production systems now rely on grafting (Kubota 2008;
King et al. 2010).
In the United States, grafting economically important vegetables on weed hosts was
common among small farmers in the past, almost around 60 years ago. Grafting is recently
gaining popularity in the U.S. for managing multiple soil-borne pathogens in the field (Freeman
et al. 2011; Kubota et al. 2008; Lee et al. 2010; McAvoy et al. 2012). More recently, several of
the studies in the United States have demonstrated the effectiveness of grafting to manage
bacterial wilt disease in open field tomato production using either the open-pollinated breeding
lines (Lin et al. 2008; Rivard et al. 2008) or using hybrid rootstocks (McAvoy et al. 2012). In
several of these studies, significant increase in yield was also observed when the susceptible
plants were grafted onto resistant rootstock (McAvoy et al. 2012). Apart from bacterial wilt,
grafting has also been proven to be effective against several other important soil- borne diseases
of tomatoes in U.S. These include root-knot nematodes (Meloidogyne spp.) (Kunwar et al. 2014;
Rivard et al. 2010), southern blight (Sclerotium rolfsii) (Rivard et al. 2010), Fusarium wilt
(Fusarium oxysporum f.sp. lycopersici) and Verticillium wilt (Verticillium dahlia) (Lows et al.
2010; Rivard et al. 2006) The level of control obtained, however, is dependent on many factors
like pathogen strain, genotype of the scion and rootstock and may other environmental factors.
Over time, multiple methods for grafting tomatoes have been developed. Among the
various methods developed, cleft grafting (requiring 3 cuts) appeared to be most effective as it
had less grafting failure (less number of grafted plants died) (Oda, 1995; Oda 1999). However,
28
since this method was labor intensive and economically not viable, a new and faster grafting
method called ‘tube grafting’ (requiring single cut) was developed in Japan (Oda, 1995). The
new method required less space as smaller plants could be grafted and with the skilled workers
available 300-500 grafts per hour could be made ready with this method (Kubota et al. 2008).
Furthermore, the development of automated robotic system for the tube grafting accelerated the
grafting process with increased success rate (> 93%; Oda, 1995). The automation process,
however, is limited only to the scion and rootstock of the same stem size, requiring planting of
more seeds than conventional non-automated grafting processes. This requirement therefore is
one of the main limitations of applying robotics in grafting. The use of adhesives like
cyanoacrylates (that are used in joining biological tissues in medical processes like dentistry and
plastic surgery (Kamer et al. 1989; Leggat et al. 2004) in grafting is, however, expected to
increase the efficiency and success rate of automated grafting (Oda, 1992)
The success of grafting depends on the physiological state of the scion and rootstock,
grafting compatibility of scion/rootstock, water and oxygen availability, grafting skill and other
environmental factors (Andrews and Marquez, 1993). Considering all these factors, the
perceived overall cost of grafting could be a major factor limiting the use of grafting in the
United States for management of soil borne diseases including bacterial wilt of tomato. The
Environmental Protection Agency website while listing grafting as an alternative to methyl
bromide states the cost of grafting vegetables to range in between $1.80 to $2.28 per plant versus
$0.41 to $0.92 per plant for non-grafted plants (King et al. 2008 and the reference therein). The
cost has been decreasing to as low as $1.00 or less per plant for watermelon in south Texas since
mid-1990s (King et al. 2008). Although no cost benefit analysis of grafting on bacterial wilt
disease management in tomato has been done in the United States, a recent study on cost benefit
29
analysis of root-knot nematode in organic tomato production reported that under high root knot
nematode pressure, grafting would be one of the most appropriate alternatives to maintain a
profitable production (Barrett et al. 2012). In addition to this, grafting being a complete non-
chemical method offers a number of advantages: i. it is a simple and easy technique and require
no highly trained expertise ii. Considerable amount of time, money and energy required for
introducing resistance gene into modern cultivars can be saved through grafting. iii. Grafting
provides disease control without compensating for the loss of important traits, a common
problem that occurs in conventional breeding while creating resistant lines iv. as a non-chemical
method, grafting has been recognized as an ideal alternative for disease control in organic tomato
production v. a substantial amount of saving obtained from the increased yield and the reduced
pesticide cost may compensates more than the increased input. Integrating grafting with
currently available chemical control methods may help to better manage bacterial wilt disease in
tomato and in other crops.
Systemic Acquired Resistance (SAR)
Researchers investigating defense response in plants found that some, after being
challenged with particular viruses or treated with Salicylic acid (SA) are stimulated to synthesize
‘pathogenesis related’ (PR) proteins which are associated with disease resistance (Van Loon and
Van Kammen, 1970; Van Loon et al. 2006). For example, tobacco plants treated with SA or
infected with Tobacco mosaic virus (TMV) were found to be resistant to subsequent TMV
infections and also had increased expression of PR protein (Van Loon et al. 2006). Apart from
the chemical and biotic inducers, physiological conditions like osmotic stress, wounding and
cold stress were also known to induce PR protein (Aglika 2005). It was only after scientists
realized this trend of PR protein accumulation, following application of Salicylic acid (SA), that
they were able to discover SAR in plants and the role of SA in plant defense.
30
SAR can be defined as the mechanism of induced resistance conferring long-lasting
broad-spectrum protection in plants against a wide array of microorganisms (Durrant et al.
2004). Induced resistance has been studied extensively in many plant pathogen interactions
under two broad classifications. i. systemic acquired resistance (SAR) and ii. induced systemic
resistance (ISR). Both SAR and ISR involve timely activation of specific defense signaling
pathways resulting in the synchronized expression of multitude PR genes (Oostendorp et al.
2001). While salicylic acid (SA) has been identified as the main upstream component of SAR
with methyl salicylate being the critical mobile signal (Park et al. 2007), ISR mainly involves
jasmonic acid (JA) and ethylene (ET) pathways. JA mediated defense pathway is mainly
activated during wound response (Dong, 1998) and has been reported to be effective against
wide range of pathogens (Pozo et al, 2005). Ethylene also plays an important role in signaling
but the resistance obtained may differ according to the type of pathogen and timing of
applications (Dong 1998). Although SA and JA/ET, plant defense pathways differ in the
upstream components, the downstream components in both the pathways appear to be similar
(Pieterse and Van Loon, 2007). Also, extensive cross talk exists between these signaling
pathways (Kachroo et al. 2007). Multiple experiments have been conducted to understand the
mechanism of induced resistance and SAR remains the best-understood mechanism of all
induced resistance. The studies revealed that the application of the SAR inducers activate some
physiological and biochemical changes in the plant thereby activating multitude of PR genes, all
leading to systemic resistance to a broad spectrum of pathogens (M´etraux et al. 1991; Walters et
al. 2005). At least seventeen different PR protein families have been reported from different
plant species (Van Loon et al. 2006). In addition to SAR induction, these host-dependent soluble
proteins could also be induced during hypersensitive response (HR). The function of many PR
31
proteins is already known. For example, PR proteins PR-2 (β-1, 3-endoglucanases), PR-3, PR-4,
PR-8 and PR-11 having chitinase activity are effective in reducing disease severity of several
bacterial and fungal pathogens (Van Loon et al. 2006). However, in case of some other PR
proteins, the exact function is yet to be understood. It is now well known that a specific set of PR
proteins are accumulated during induction of SAR. Thus, the relative expression of the specific
PR gene has widely been exploited to assess SAR level in plant. In tomato, a specific PR gene
called PR1a was used as the marker for assessing induction of SA pathway (Block et al. 2005).
Herman et al. (2008) reported induction of PR1a, PR1b and Pin II as markers to assess the
induction of SA, ET and JA pathways, respectively. The induction was assessed following two
applications of an SAR inducing chemical, ASM in three field grown tomato cultivars Rutgers,
RioGrande and Supersonic. ASM induced SA and ET defense pathways in all of the three tomato
cultivars, each differing in timing and intensity, but ASM showed no effect on the JA mediated
defense response in any of the of the cultivars (Herman et al. 2008).
Further research on the mechanism of SAR was accelerated as many SAR mimicking
chemicals like ASM were discovered (Oostendorp et al. 2001). Till date, significant numbers of
chemical inducers of SAR have been identified and commercialized. Among them ASM (a
synthetic analog of SA belonging to the benzothiadizaole; BTH group) is one of the most widely
used SAR inducers available.
Released in 2000, ASM contains benzo [1,2,3] thiadizaole-7-carbothioic acid-S-methyl
ester as the active ingredient (Syngenta Crop Protection, Inc. Greensboro, NC. U.S.A). In
Europe, ASM was registered under the name BION® (Syngenta Ltd. Basel, Switzerland), and
was widely used to control powdery mildew of barley (Hordeum vulgare L.) and wheat
(Triticum aestivum L.) (Novartis Crop Protection, 1999). In the United States, ASM was
32
registered under the name Actigard® (Syngenta Crop Protection Inc.Greensboro, NC) in 1998
and was identified as a reduced risk compound for use on tomato, tobacco (Nicotiana tabacum
L.), cole crops, and leafy vegetables like spinach (Spinacea oleracea). ASM has been reported to
elicit SAR within 4 days providing broad-spectrum resistance against many bacterial, fungal and
viral infections in plants (Syngenta Crop Protection, 2001). In the United States, it was
demonstrated to protect tobacco against Tomato spotted wilt virus when combined with an
insecticide, imidacloprid (Pappu et al. 2000). Currently in the U.S, ASM is used for controlling
bacterial leaf spot and leaf speck of tomato, blue mold of tobacco, downy mildew of leafy
vegetables and cole crops, white rust of spinach and black rot of cole crops (Syngenta Crop
Protection, 2001). Recently, experiments have been conducted to evaluate the effect of ASM on
the management of bacterial wilt disease of tomato.
Acibenzolar-S-Methyl for Bacterial Wilt Management of Tomato
In a greenhouse experiment conducted by Anith et al. 2004, initial foliar application of
ASM followed by a second application (given as both foliar spray and soil drench) significantly
reduced bacterial wilt disease in the susceptible tomato cultivar (cv. Solar Set) at low
concentration of bacterial inoculum (<106 CFU/mL). However, at high bacterial inoculum
concentration, ASM showed no effect on the disease incidence in the susceptible cultivar. In the
field experiments, foliar application of ASM significantly reduced disease incidence in the
moderately resistant tomato cultivars, BHN 466, Neptune and FL 7514 (Pradhanang et al. 2005).
A significant improvement in the yield was also evident in these moderately resistant cultivars
treated with ASM as compared to the untreated control. However, in the same study, it was
evident that in susceptible cultivars foliar application of ASM had no effect on the disease
incidence (Pradhanang et al. 2005). Few of the studies in the past have stated that the soil
33
application of SAR inducers provides better and persistent disease control compared to foliar
treatment (Graham et al. 2011).
34
A B
C
Figure 1-1. Symptoms of bacterial wilt disease in tomato plants infected with Ralstonia
solanacearum (race 1, biovar 1). A) Severe wilting and stunting of the infected plant
in the field. B) Vascular discoloration of an infected stem and C) Adventitious root on
an infected stem.
A B
Figure 1-2. Pure culture of Ralstonia solanacearum on A) CPG media and B) modified SMSA
media.
35
CHAPTER 2
SCREENING OF BACTERIAL WILT RESISTANCE IN NEW HYBRID TOMATO
ROOTSTOCKS
Introduction
Bacterial wilt caused by Ralstonia solanacearum (R. solanacearum) (Smith, 1896) is one
of the most important diseases of plants in the family Solanaceae (Hayward, 1991). The disease
is found in tropics, sub-tropics and temperate regions of the world and affects wide range of
crops including almost 200 plant species in 50 different families (Denny 2000; Hayward et al.
1994; Milling et al. 2009). Currently divided into four phylotypes, (I, II, III and IV), the
pathogen exhibits significant variability within the species (Fegan et al. 2005). In the United
States, Rs5 (race1, biovar 1, phylotype II) is widely distributed in the southeastern states and
causes yield losses on tomato (Ji et al. 2007), a vegetable crop of economic importance. The
diversity of the strains, wide geographical distribution, numerous plant hosts and the ability to
survive in the soil, water and roots of non-hosts for many years are the main reasons that hinder
the successful management of the bacterial wilt.
The use of the resistant cultivars has been proposed to be the most effective and practical
way of controlling the bacterial wilt disease. Thus, genetic improvement of the host plant
resistance has been the main focus in bacterial wilt management. In tomato, many cultivars
resistant to bacterial wilt are available. Some improved varieties with desirable bacterial wilt
resistance have been reported in some countries of Asia and North America that includes India,
Indonesia, Philippines, Thailand and the U.S. (Boshou et al. 2008). However, breeding for
resistance against bacterial wilt in tomato is constrained by various factors. Some of the main
factors include limited resistant source available for breeding, enormous diversity within the
strains of the pathogen and genetic linkage of the resistance traits to one or more unwanted
agricultural traits. In the tomato varieties H7996, H7997 and H7998, which are all resistant to
36
bacterial wilt (Chellemi et al. 1994; Grimault and Prior. 1993; Grimault et al. 1995 and Scott et
al. 2009), the resistant trait has been reported to be linked with small fruit size, an undesirable
horticultural trait (Opena et al. 1990; Wang et al. 1998), and are therefore not accepted by
producers. Although large fruited varieties with high level of resistance against bacterial wilt are
available, there are only few varieties available (Scott et al. 2009). All of the above aspects have
increased interest to evaluate these otherwise non-preferred bacterial wilt resistant sources as
improved rootstock sources for grafting. Grafting, as a technique to manage many soil-borne
diseases, is increasingly gaining interest in the U.S. as an alternative method for managing many
soil borne diseases including bacterial wilt disease of tomato (King et al. 2008; McAvoy et al.
2012). There is active research in breeding for development of bacterial wilt resistant rootstocks
for use in grafting. A preliminary screening of bacterial wilt resistance in these new sources is
necessary before evaluating the possibility of using them in grafting for managing bacterial wilt
disease in tomato.
In this study, two greenhouse experiments were conducted to evaluate the bacterial wilt
resistance in twenty-eight new tomato hybrid rootstocks. Among the hybrid rootstocks tested,
three of the hybrids; WG12-110, WG12-120 and WG12-140 did not show any wilting symptoms
during the entire 21 days post inoculation (dpi) period of the experiment, similar to BHN 998
and H7997, and thus were considered bacterial wilt resistant. At 21 dpi, the stem sections of
these resistant hybrid rootstocks were evaluated for latent infection. Bacteria were recovered
from all three resistant hybrid rootstocks. The bacterial population in these resistant hybrids was
statistically similar to that in BHN 998 and H7997 (P=0.05). There was no significant difference
between the bacterial population recovered from BHN998 and H7997.
37
Further studies on grafting compatibility of these resistant hybrid rootstocks to
susceptible scions would provide information on the potential of incorporating these resistant
hybrid rootstocks in grafting against bacterial wilt disease of tomato. Also, since resistance to
bacterial wilt is unstable due to the complex interactions between the widely diverse genetic
characters of the pathogen, host genotype and environmental conditions (Scott et al. 2005),
evaluating the resistance stability of these hybrid rootstocks against other tropical, subtropical
and temperate strains of R. solanacearum may be necessary for effective disease control across
wide environmental conditions.
Materials and Methods
Bacterial Culture
Rs5 strain (characterized as race 1, biovar 1, phylotype II, sequevar 7) of Ralstonia
solanacearum, isolated from tomato in Quincy, FL. (Ji et al. 2007) was used in the greenhouse
experiments. A pure bacterial culture was prepared by single colony streaking method. Streaking
was done on a CPG (Casamino acid: peptone: glucose - 1:10:5) agar growth media and incubated
at 28°C. After 48 hours of incubation, Rs5 culture was confirmed in the plates with
Immunostrips (Agdia, Inc. Elkhart, IN ISK 33900/0025). The mucoid colonies of the bacteria
were further suspended in sterile deionized water. Optical Density (OD) of the suspension was
adjusted to 0.1 at 600nm that corresponds to ~108 colony forming units (CFU/mL). The bacterial
suspension was further diluted 10 fold to obtain the final bacterial population of 107 CFU/mL,
which was used for inoculation.
Plant Material
Seeds of twenty-eight hybrid tomato (Solanum lycopersicum) rootstocks were obtained
from the Ohio State University (OSU) tomato-breeding program (Table 2-1). 10 seeds of each
hybrid rootstock along with commercially available bacterial wilt resistant rootstock BHN 998
38
and resistant variety H7997 and one bacterial wilt susceptible cultivar BHN 602 were sown in
polystyrene flats (4.4 × 4.4 × 6.3 cm) in a peat vermiculite mixture (Metro mix®, Sun Gro
Horticulture Canada Ltd, Agawam, MA) and allowed to germinate. Two weeks after seedling
emergence, the seedlings were transferred to 10-cm pots and were grown in the greenhouse
under natural sunlight condition with a temperature of 26- 30°C (day) and 18-23°C (night). The
photoperiod in Quincy, FL, during the experiment was ~13 hours/day from mid-March to mid-
April, 2013 when the experiments were conducted.
Greenhouse Experiments
Two greenhouse experiments were conducted with three replicates in each experiment.
Bacterial inoculum was poured into 10-cm diameter plastic pots filled with peat vermiculite
mixture (50 mL/pot), and each pot contained a single plant. Mechanical wounding (6 cm long
and 6 cm deep cut on one side of the root 2 cm away from the crown region) was done on the
roots of all plants in both the experiments before inoculation. The plants were then kept inside
the greenhouse with a temperature range set between minimum of 20-24°C and maximum of 32-
38°C throughout the experiment. The plants were irrigated daily with 80-100 mL of tap water.
Three days following inoculation, disease severity (DS) of all the plants was scored daily on a
scale of 0-4 with 0= no leaf area wilted, 1= 1 to 25% of the leaf area wilted, 2= 26-50% of the
leaf area wilted, 3= 51 to 75% of the leaf area wilted and 4= 76-100% of the leaf area wilted
(Jacobs et al. 2011) and mean percentage DS was calculated for each hybrid. Since the disease
progression curve and percentage DS data of the hybrid rootstocks in the two experiments were
similar, the data was combined (Table 2-1; Figure 2-1). The cause of wilting of the plants was
confirmed to be R. solanacearum by plating sap from the infected stem tissue in modified SMSA
medium, a semi-selective media for isolation of R. solanacearum from planting materials,
contaminated irrigation water and from contaminated soil (Engelbrecht 1994). In both
39
experiments, the resistant rootstocks, showing no wilting symptoms, were tested for latent
infection along with BHN 998 and H7997. One gram of fresh tissue (collar region) of the plant
stem was weighed and ground in 1 mL of sterile distilled water. A series of 10-fold dilutions (10-
1 - 10
-7) of the initial suspension was made. Hundred microliter of each dilution was then plated
on modified SMSA medium. The bacterial population per gram of the fresh tissue was then
calculated using the formula, bacterial population (CFU/g fresh tissue) = No of colonies ×
Dilution factor × 10. Since statistically similar results were obtained for each hybrid in both of
the experiments, the population data of the two experiments were combined and presented as one
(Figure 2- 3). Since all the plants in the susceptible cultivar, BHN 602, completed wilted by the
second week of inoculation, bacterial assessment was not done in this cultivar.
Statistical Analysis
Both the greenhouse experiments were set up in a complete randomized design (CRD).
The bacterial population and percentage DS data were then subjected to analysis of variance
(ANOVA) using SPSS software version V22. For all the experiments, means were separated
using Student-Newman-Keuls test (SNK) at P=0.05.
Result
Different hybrid rootstocks displayed different disease progression pattern, over a period
of 21 dpi (Figure 2-1) (Table 2-1). In both the greenhouse experiments, no wilting was observed
in any of the hybrid rootstocks until 4 dpi. At 4 dpi, highest DSI was observed in two of the
hybrid rootstocks WG12-134 and WG12-136 (DSI = 29.17). While the DSI for WG12-136
increased to 83.33 at 8 dpi and remained constant throughout, DSI for WG12-134 reached 100
(all plants died) by 8 dpi. Similar to hybrid rootstocks, wilting started 4 dpi in BHN 602, a
bacterial wilt susceptible cultivar, with DSI of 8.33, which increased to 91.67 by 10 dpi and
remained constant throughout. At 7 dpi, DSI of the hybrid rootstocks WG12-110, WG12-117,
40
WG12-120, WG12-121, WG12-129, WG12-130 and WG12-140 were statistically similar to
BHN 998 and H7997. However, all the other hybrid rootstocks (WG12-101, WG12-108, WG12-
111, WG12-112, WG12-114, WG12-115, WG12-116, WG12-118, WG12-122, WG12-123,
WG12-124, WG12-125, WG12-127, WG12-128, WG12-131, WG12-132, WG12-135, WG12-
136, WG12-137 and WG12-138) displayed DSI values that were intermediate of susceptible
cultivar BHN 602, and resistant lines BHN 998 and H7997. DSI values of the symptomatic
plants in the hybrid rootstocks, at 7dpi, ranged from the most severe value of 91.67 (WG12-
134), which was significantly greater than that of susceptible cultivar BHN 602 (DSI = 58.33), to
the least severe value of 8.33 (WG12-130). At 14 dpi, DSI values of the hybrid rootstocks ranged
from maximum values of 100 (WG12-123, WG12-134 and WG12-137), to minimum values of
20.84 (WG12-130) in the symptomatic plants. At 14 dpi, six of the hybrid rootstocks (WG12-
110, WG12-120, WG12-130 and WG12- 140) had significantly lower disease than the
susceptible control BHN 602 as shown in Table 2-1 and were statistically similar to BHN 998
and H7997. All other hybrid rootstocks except (WG12-123, WG12-134 and WG12-137) were
similar to the susceptible cultivar, BHN 602. At 14 dpi, three of the hybrid rootstocks, WG12-
123, WG12-134 and WG12-132, had significantly greater DSI than BHN 602. During the 21 dpi
period of the experiment, the least disease severity was displayed by hybrid WG12- 130 (DSI =
20.83 at 21 dpi). Throughout the experiment, DSI value of hybrid rootstock WG12-130 remained
statistically similar to BHN 998 and H7997. At the end of the experiment (21 dpi), three of the
hybrid tomato rootstocks, WG12-110, WG12-120 and WG12-140, did not show any wilting
symptoms (Table 2-1) (Figure 2-1 & Figure 2-2) and were similar to BHN 998 and H7997.
Assessment of the bacterial colonization, at 21 dpi, in the collar region of WG12-110, WG12-
120 and WG12-140, BHN 998 and H7997 confirmed latent infection in all with recovery of Rs5
41
colonies from asymptomatic plants. However, there was no statistical difference between
bacterial population recovered from BHN 998, H7997 and the latently infected rootstocks
(Figure 2-3).
Discussion
During the early infection process, R. solanacearum enters the root of the host plant
mainly via wounds and through lateral root emerging sites. The initial invasion process takes less
than 4 hours, which is generally followed by the colonization of the inner cortex and vascular
parenchyma (Schell. 2000). The colonization process usually takes place over 2-3 days during
which the symptom is not visible (Schell 2000; Vasse et al. 1995). In this study, wilting
symptoms was not observed in any of the hybrid rootstocks until 3 dpi. This time period between
inoculation and symptom onset is the time required by the bacteria to invade and colonize the
cortex and vascular tissue of the host. Once established R. solanacearum starts dissolving plant
cell wall and produces slimy bacterial debris within. This debris along with the copious amount
of bacterial exopolysaccharide plugs the xylem vessels (Shew et al. 1991) eventually producing
wilting symptoms in the infected plant. In this study, a rapid increase in disease severity for most
hybrid rootstocks began 4 dpi and continued increasing till 8 dpi during which most of the
wilting symptoms were observed. It has been reported that by day eight, the bacterial population
in the symptomatic plant could reach as high as 1010
CFU/cm in infected stem (Schell et al.
2000). In hybrid rootstocks WG12-123, WG12-134 and WG12-137, the rapid increase in disease
severity was followed by a complete wilting of all the plants. In contrast to this, in hybrid
rootstocks, WG12-129 and WG12-130, despite the initial steep rise of the disease severity during
7- 8 dpi, DSI remained constant during 14-21 dpi suggesting an intermediate resistance in these
hybrid rootstocks. In this study, different classes of intermediate resistances were observed
42
among the hybrid rootstocks. Similar classes of resistance against R. solanacearum have been
previously reported (Lebeau et al. 2010).
Several types of genetic control have been attributed to bacterial wilt resistance (Acosta
et al. 1964; Anais et al. 1986; Anand et al. 1993; Digat and Derieux. 1968; Tikoo et al. 1983).
The effect of the host genetics on bacterial resistance is further affected largely by environmental
conditions thereby making the studies on the host- pathogen interactions involving R.
solanacearum more complicated. The purpose of this study was to screen the hybrid rootstocks
for resistance to bacterial wilt disease so their potential use in grafting could be determined. The
study on the genetics of the individual hybrid is therefore beyond the scope of the study and only
the genetic sources of the most resistant hybrid rootstocks (WG12-110, WG12-120 and WG12-
140) have been focused. All of the three resistant hybrid rootstocks WG12-110, WG12-120 and
WG12-140 were derived from H7997, one of the most resistant and most stable bacterial wilt
resistant variety worldwide, thought to be derived from PI127805A (L.pimpinellifolium) (Hanson
et al. 1998). H7997 is speculated to contain a collection of bacterial wilt quantitative trait loci
(QTL) in chromosome 6, making it resistant to most of the R. solanacearum strains
(Gnanamanickam et al. 2007).
Although no symptoms were evident, the assessment of the bacterial recovery in the
collar region revealed latent infection in all of the resistant hybrid rootstocks including BHN 998
and H7997. Although the mechanism of how latent infection (an asymptomatic plant harboring
bacteria in the stem) affects resistance is yet to be investigated, latent infection has recently been
distinguished as one of the two major plant defense mechanisms against bacterial wilt. It is now
clear that some of the accessions with their stems colonized partially or completely by R.
solanacearum still do not produce any wilting symptoms (Lebeau et al. 2010). Although latent
43
infection has been proposed to be one of the defense mechanisms against bacterial wilt,
especially in pepper host, implication of latent infection in tomato host for defense against
bacterial wilt, as observed in this study, however, is in contrast to the result found by Lebeau et
al. 2010 which states that wilting in tomato occurs soon after bacteria gets established in the
plant. Many of our other experiments on colonization of tomato stem by R. solanacearum
suggest latent infection is common in tomato (data unpublished). Further research is therefore
necessary to elucidate the occurrence and role of latent infection in resistance of tomato host
against R. solanacearum.
McGarvey et al. 1999 pointed out that greater amount of expolysaccharides (EPS) is
produced in the susceptible cultivar as compared to the resistant cultivar. In this study, we found
that although the resistant hybrid rootstocks and rootstocks were heavily colonized they still
remained asymptomatic. We speculate that despite reaching high bacterial population, enough
EPS might not have been produced in these resistant lines to clog the xylem vessels and thus no
disease symptoms were evident. Further experiment on quantification of EPS in these latently
infected resistant lines versus the symptomatic susceptible cultivar is therefore needed for better
understanding.
As these hybrids were developed for use in grafting as resistant rootstock sources, it is
prudent to check the grafting compatibilities of these resistant hybrid rootstocks (WG12-110,
WG12-120 and WG12-140). In addition, they potentially make an improved alternative source
for resistance breeding against bacterial wilt disease. In this study, the resistance of the hybrid
rootstocks were tested only against Rs5 (race 1, biovar 1, phylotype II, sequevar 7), at a single
location in Quincy, Florida. Bacterial wilt disease is highly dependent on environmental
conditions and genetic material found resistant in one region might be susceptible in some other
44
regions depending on environmental conditions and dominant strains prevailing in that area.
Moreover, the heritability of resistance to bacterial wilt disease is polygenic and could be broken
easily once the environmental condition becomes favorable (Thoquet et al. 1996). Thus, in this
scenario it is prudent to evaluate the stability of the resistance in the hybrid rootstocks (WG12-
110, WG12-120 and WG12-140) at different geographical locations for more effective and wider
application of these hybrid rootstocks.
45
Table 2-1. Mean percentage disease severity of 28 new tomato hybrid rootstocks inoculated with
107 CFU/mL of Ralstonia solanacearum (Rs5 strain) at 7, 14 and 21 days post
inoculation.
Entry DS % (7dpi) DS % (14 dpi) DS % (21 dpi) Resistance
BHN 998 00.00 a 00.00 a 00.00 a Resistant
H7997 00.00 a 00.00 a 00.00 a Resistant
BHN 602 58.33 ab 91.67 cd 91.67 cd Susceptible
WG12-101 45.83 ab 75.00 b-d 66.67 b-d Susceptible
WG12-108 33.33 ab 58.33 a-d 66.67 b-d Susceptible
WG12-110 00.00 a 00.00 a 00.00 a Resistant
WG12-111 41.67 ab 58.33 a-d 62.50 b-d Susceptible
WG12-112 33.33 ab 66.67 a-d 75.00 b-d Susceptible
WG12-114 37.50 ab 50.00 a-d 54.17 a-d Susceptible
WG12-115 29.17 ab 87.50 b-d 91.67 cd Susceptible
WG12-116 33.33 ab 75.00 b-d 83.33 b-d Susceptible
WG12-117 12.50 a 41.67 a-d 62.50 b-d Susceptible
WG12-118 37.50 ab 70.83 b-d 79.17 b-d Susceptible
WG12-120 00.00 a 00.00 a 00.00 a Resistant
WG12-121 12.50 a 25.00 a-c 29.17 a-c Susceptible
WG12-122 25.00 ab 37.50 a-d 41.67 a-d Susceptible
WG12-123 58.33 ab 100.00 d 100.00 d Susceptible
WG12-124 37.50 ab 75.00 b-d 75.00 b-d Susceptible
WG12-125 37.50 ab 45.83 a-d 66.67 b-d Susceptible
WG12-127 25.00 ab 62.50 a-d 91.67 cd Susceptible
WG12-128 33.33 ab 50.00 a-d 54.17 a-d Susceptible
WG12-129 16.67 a 29.17 a-d 29.17 a-c Susceptible
WG12-130 8.33 a 20.84 ab 20.83 ab Susceptible
WG12-131 29.17 ab 41.67 a-d 58.33 a-d Susceptible
WG12-132 41.67 ab 66.67 a-d 79.17 b-d Susceptible
WG12-134 91.67 b 100.00 d 100.00 d Susceptible
WG12-135 50.00 ab 70.83 b-d 70.833 b-d Susceptible
WG12-136 75.00 ab 83.33 b-d 87.50 cd Susceptible
WG12-137 66.67 ab 100.00 d 100.00 d Susceptible
WG12-138 58.33 ab 70.83 b-d 83.33 b-d Susceptible
WG12-140 00.00 a 00.00 a 00.00 a Resistant
46
Figure 2-1. Percentage disease severity of the 28 new tomato hybrid tomato rootstocks
inoculated with 107 CFU/mL of R. solanacearum (Rs5 strain).
0
20
40
60
80
100
120
3 4 5 6 7 8 9 10 11 12 13 14
Days post inoculation
Dis
ea
se s
ev
erit
y (
%)
BHN998
H7997
BHN602
WG12-101
WG12-108
WG12-110
WG12-111
WG12-112
WG12-114
0
20
40
60
80
100
120
3 4 5 6 7 8 9 10 11 12 13 14
Days post inoculation
Dis
ease
sever
ity (
%) WG12-116
WG12-117
WG12-118
WG12-120
WG12-121
WG12-122
WG12-123
WG12-124
0
20
40
60
80
100
120
3 4 5 6 7 8 9 10 11 12 13 14
Days post inoculation
Dis
ease
sever
ity (
%)
WG12-128
WG12-129
WG12-130
WG12-131
WG12-132
WG12-134
WG12-135
WG12-136
WG12-137
47
A B
C D
E F
Figure 2-2. The hybrid rootstocks along with resistant and susceptible control at 21 days post
inoculation with R. solanacearum (Rs5 strain) suspension adjusted to 107 CFU/mL.
A) BHN 998, bacterial wilt resistant rootstocks B) H7997, bacterial wilt resistant
variety C) WG12-110, D) WG12-120 and E) WG12-140, the resistant hybrid
rootstocks and F) BHN 602, bacterial wilt susceptible cultivar.
48
Figure 2-3. Bacterial population in the collar region of the bacterial wilt resistant BHN 998 &
H7997 and in resistant hybrid tomato rootstocks (WG12-110, WG12-120 & WG12-
140) at 21 days post inoculation with R. solanacearum suspension adjusted to 107
CFU/mL. The error bars indicate the standard error of mean. Columns means with the
same letter do not differ significantly at P=0.05 based on Student-Newman-Keuls
(SNK)
a a a a a
-0.4
0.6
1.6
2.6
3.6
4.6
5.6
6.6
7.6
8.6
BHN998 H7997 WG12-110 WG12-120 WG12-140
Ba
cter
ial p
op
ula
tio
n
(Lo
g C
FU
/mL
)
49
CHAPTER 3
EFFECT OF FOLIAR AND DRENCH APPLICATION OF ACIBENZOLAR-S-METHYL ON
THE INDUCTION OF DEFENSE GENES AGAINST BACTERIAL WILT DISEASE OF
TOMATO
Introduction
Bacterial wilt caused by Ralstonia solanacearum (R. solanacearum) is one of the most
serious diseases of tomato (Solanum lycopersicon) worldwide. Known to infect over 200 plant
species in 50 different families, the bacterium is a major production constrain of numerous other
economically important crops like potato, tobacco, eggplant, pepper, banana and ornamentals
like geranium (Hayward et al. 1994; Janse et al. 2004). Because of the wide host range,
enormous genetic diversity and global distribution that encompasses tropical, sub-tropical and
temperate regions of the world, the bacterium has been listed as one of the top ten plant
pathogens of the world (Mansfield et al. 2012).
Many studies have been conducted in the past to uncover the fate of this xylem invader in
the tomato host (Denny, 2000 and 2006; Vasse et al. 1995). R. solanacearum initially colonizes
the root surface, preferably at the intercellular grooves of the root elongation zone and
intercellular spaces in the lateral root cracks. It further colonizes the root cortex where it
undergoes rapid multiplication (>1010
colony forming units; CFU/g fresh tissue) and finally
invades the xylem vessels thereby spreading throughout the vascular system. Two of the key
bacterial products; exopolysaccharides (EPS) and multiple extracellular proteins (EXPs)
produced in copious amount during colonization are believed to be essential for wilting
symptoms to develop as observed in infected tomatoes and many other symptomatic hosts. In
part of the host, tomato responds to R. solanacearum infection by inducing two of the key
phytohormone-mediated defense-signaling pathways: salicylic acid pathway (SA) and ethylene
pathway (ET) (Milling et al. 2011). The induction however occurs much later in the susceptible
50
genotype thereby producing more disease symptoms as compared to in the resistant line in which
early induction of SA and ET signaling halts disease progression. However, no effect on the
Jasmonic acid mediated response (JA) was evident in either susceptible or resistant tomato lines
following bacterial inoculation. Interestingly, a highly virulent temperate strain, UW551, was
found to reduce host defense by repressing SA and ET mediated defense signaling in susceptible
tomato cultivar (Bonny best). This strain, which caused repression of ET signaling in H7996, (a
line resistant to a majority of R. solanacearum strains) and delayed SA induction in H7997,
caused some wilting. These observations taken together indicate that, bacterial wilt disease of
tomato is, at least, in part, is due to the inadequate or late induction of SA and ET pathways; both
of which are highly manipulated during bacterial wilt disease development. Therefore, timely
triggering of these two key defense signaling pathways in tomato without inversely affecting
plant health and yield would be expected to give desirable bacterial wilt disease control and
profitable production of tomato.
Induction of SA and ET defense pathways in three field grown tomato cultivars was
demonstrated by Herman et al in 2008, following two foliar applications of Acibenzolar-S-
Methyl (ASM; Syngenta Crop Protection, Inc. Greensboro, NC. U.S.A). ASM, a functional
analog of salicylic acid (SA) is a commercially available plant activator known to elicit systemic
acquired resistance (SAR) in plants against a broad spectrum of diseases (Buonaurio et al. 2002;
Huang et al. 2011; Louws et al. 2001; Pradhanang et al. 2005; Vallad and Goodman. 2004). SAR
induction is associated with local and systemic accumulation of SA and is accompanied by
synchronized induction of specific array of genes called pathogenesis related (PR) genes
(Durrant and Dong, 2004). In tomato, ET has been implicated to play a key role in disease
resistance in cooperation with SA (Block et al. 2005) in contrast to Arabidopsis where ET in
51
cooperation with JA has been demonstrated to control a distinct pathway antagonistic to the SA
pathway (Dangl. 2000). In the study by Herman et al. 2008 and in other related studies, no
apparent induction/repression of JA mediated response was evident in tomato leaf with ASM
treatment. In consistent with the speculation that ASM mediated induction of SA and JA would
possibly help control bacterial wilt disease in tomato, a significant reduction in disease severity
in the greenhouse grown tomato, at low bacterial concentration <106 CFU/mL), was reported in
susceptible tomato cultivar (cv. Solar Set) following two applications of ASM (initial foliar
application followed by a second application both as foliar spray and soil drench). However, no
effect on disease incidence was evident at high bacterial pressure (Anith et al. 2004). In the field
experiments, foliar application of ASM was shown to significantly reduced disease incidence
and improve yield of three tomato cultivars, BHN 466, Neptune and FL 7514; all three
genotypes were previously shown to be moderately resistant to bacterial wilt (Pradhanang et al.
2005). Interestingly, no effect on the disease incidence was evident in susceptible cultivars
treated with ASM in the field as foliar spray (Pradhanang et al. 2005). Few studies in the past
have demonstrated that the soil application of SAR inducers provide better disease control
compared to foliar treatment. For example, Graham et al (2011) demonstrated that soil
application of three of SAR inducer, Imidacloprid, Thiamethoxam and ASM reduced incidence
of citrus canker in young grapefruit trees. In this scenario, it would be interesting to see if
drench application of ASM instead of foliar would give comparatively better control of soil
borne, bacterial wilt disease, by upregulating key defense signaling pathways in tomato roots.
The objectives of this study were to compare the foliar versus drench application of ASM
for efficacy in controlling bacterial wilt disease in tomato and to investigate the fate of three key
52
defense signaling pathway SA, ET and JA, in tomato leaves and roots following foliar versus
drench application of ASM.
Materials and Methods
Bacterial Culture and Inoculum Preparation
R. solanacearum tomato strain Rs5 (race 1, biovar 1, phylotype II, sequevar 7) isolated
from infected tomato in Quincy, FL was used in the study. The pure culture of Rs5 was streaked
on casamino acid peptone glucose (CPG) agar (Kelman, 1954), incubated at 28°C for 48 hours
and confirmed as being R. solanacearum with Immunostrips® (Agdia, Inc. Elkhart, IN ISK
33900/0025). Bacterial suspension was prepared in sterile deionized water and the suspension
was adjusted with a spectrophotometer to an optical density (OD) of 0.1 at 600nm, which
corresponds to ~108 colony forming units/milliliter (CFU/mL). The resulting suspension was
then diluted to 107 CFU/mL in sterile deionized water and used for plant inoculation.
Greenhouse Experiments
Three greenhouse trials (Trial 1, Trial 2 and Trial 3) were conducted to evaluate the
effectiveness of foliar versus drench application of ASM for bacterial wilt management in
tomato. Experiments were conducted at two different locations at the University of Florida;
North Florida Research and Education Center (NFREC) in Quincy, FL (Trial 1) and Plant
Pathology Department in Gainesville, FL (Trial 2 and 3). Two tomato genotypes BHN 602, a
bacterial wilt susceptible cultivar and BHN 998, a bacterial wilt resistant rootstock were used
throughout the study. Seeds of BHN 602 and BHN 998 were sown in peat vermiculite mixture
(Metro mix®
, Sun Gro Horticulture Canada Ltd, Agawam, MA) and allowed to germinate either
in the polystyrene germinating flats (4.4 × 4.4 × 6.3 cm) or in the10-cm pots (~20 seeds/pot).
Two weeks later, seedlings were transplanted individually into 10-cm pots containing peat
vermiculite mixture and allowed to grow under natural sunlight conditions in the greenhouse.
53
Trial 1, 2 and 3 were conducted, respectively with three, eleven and eight plants for each
treatment, with each plant being a replicate. In all the experiments, two applications of ASM (50
mg/L) were given to the transplants at 3-4 leaf stage at a seven day interval. ASM was applied
either as foliar spray (sprayed onto the lower and upper leaf surface with a handheld sprayer until
runoff) or soil drench (50 mL of solution poured at the base of the plant in the peat vermiculite
mixture). Two days following a second ASM treatment, 50 mL of bacterial suspension (107
CFU/mL) was drenched at the base of mechanically wounded roots in the peat vermiculite
mixture. Wounding was done by making a sharp cut 6 cm long and 6 cm deep on one side of the
root, 2 cm away from the collar region.
While all the inoculated plants in Gainesville, FL trials were allowed to grow under
natural sunlight conditions in the greenhouse, the inoculated plants in Trial 1 conducted at
Quincy, FL. were grown at a controlled greenhouse temperature range between minimum of 20-
24°C and maximum of 32-38°C throughout the experiment. Following inoculation, disease
severity (DS) of all the plants was scored daily on a scale of 0-4 with 0= no leaf area wilted, 1= 1
to 25% of the leaf area wilted, 2= 26-50% of the leaf area wilted, 3= 51 to 75% of the leaf area
wilted and 4= 76-100% of the leaf area wilted (Jacobs et al. 2011) and mean percentage DS was
calculated for each treatment. The cause of wilting of the plants was confirmed to be R.
solanacearum by observing the characteristic colonies after plating sap from the infected stem
tissue in modified SMSA media. Modified SMSA is a semi-selective medium for isolation of R.
solanacearum from planting materials, contaminated irrigation water and from contaminated soil
(Engelbrecht 1994).
Gene Expression Studies
PR1a, PR1b and Pin II are, respectively, the markers of SA, ET and JA defense signaling
pathways in plants. In this study, change in the expression of PR1a, PR1b and Pin II was
54
quantified in the leaf and root tissues of BHN 602 treated with ASM relative to the
corresponding water treated controls.
Plant Materials and Treatment
Seeds of BHN 602 (~120 seeds) were allowed to germinate in the peat vermiculite
mixture and seventy-two germinated seedlings were transplanted individually into 10- cm pots
containing peat vermiculite mixture. The transplants were allowed to grow under natural sunlight
conditions in the greenhouse. Ten days after transplanting to pots, the seedlings were divided
into four groups (I, II, III, IV); each group containing eighteen seedlings. The plants in groups I
and II were sprayed with water and ASM (50 mg/l), respectively and plants in groups III and IV
were drenched at the base of the plant with 50 mL of water and ASM (50 mg/l), respectively.
The plants in each treatment received a second application, seven days later.
Tissue collection and RNA extraction: Leaf and root samples from each of the four
groups (I, II, III and IV) were collected individually at three different time points (24, 48 and 72
hours) after second ASM application. The term ‘post application’ was used in short throughout
the text for referring to ‘post second ASM application’. There were three biological replicates for
each group (treatment) per time point. All sample collections were done at 10.00 a.m. Leaf
samples were frozen in liquid nitrogen immediately following collection. For the root samples,
DEPC (Diethyl pyrocarbonate) treated water (0.05%) was used for clearing the soil residues in
the roots following initial cleaning under running deionized water for few minutes. Each of the
leaf and root samples (100 µg) were ground in liquid nitrogen and total RNA was extracted using
RNeasy Plant mini kit (Qiagen, Valencia, CA) in a 20 mL reaction volume. The extracted RNA
was quantified and checked for purity using nanodrop and was further diluted to 200ng/µl. The
RNA was then treated with DNAseI enzyme using Turbo DNA-FreeTM Kit (Life Technologies-
55
Cat. No. AMI907). After inactivating the DNAse enzyme, RNA was stored at -80°C for further
gene expression analysis.
Gene expression studies using quantitative real time - PCR (qRT-PCR): All primers and
probes used in this study were identical to those described by Block et al. 2005 and Herman et al.
2007: PR1a forward primer 5’-GAGGGCAGCCGTGCAA-3’; PR1a reverse primer 5’-
CACATTTTTCCACCAACACATTG-3’; PR1b forward primer 5’-GGTCGGGCACGTTGCA-
3’; PR1b reverse primer 5’-GATCCAGTTGCCTACAGGACATA-3’; Pin II forward primer 5’-
TGATGCCAAGGCTTGTACTAGAGA -3’; Pin II reverse primer 5’-
AGCGGACTTCCTTCTGAACGT -3’; Actin forward primer 5’- TTGCCGCATGCCATTCT -
3’; Actin reverse primer 5’- TCGGTGAGGATATTCATCAGGTT -3’. The relative expression
ratios of the three genes were quantified with iQ5 Multicolor Real-Time PCR Detection System
using Biorad two-step qRT-PCR reagents (Bio-Rad Laboratories, Hercules, CA). The cDNA
synthesis and reverse transcription were done using iScript Select cDNA Synthesis Kit (Bio-Rad
Laboratories, Hercules, CA) using 1µg of total RNA in a 20 µl reaction volume that consisted of
4 µl 1X iScript reaction mix, 2 µl random hexamer primers and 1 µl iScript reverse transcriptase.
Controls without reverse transcriptase were also included to check possible DNA
contaminations. The reaction conditions were: 25°C for 5 min, 42°C for 30 min and 85°C for 5
min. Following the reverse transcription, cDNA product obtained from each sample was stored
at -20°C for further assay of the expression of three defense genes in tomato. qRT-PCR was
done using using iQ™ SYBR® Green Supermix (Bio-Rad Laboratories, Hercules, CA, Cat
#170-8880). Each reaction (20 µl) consisted of 1X SYBR Mix, forward and reverse primers
(300nM) and 2 µL of cDNA. Cycling conditions consisted of 95°C for 1 min, followed by 45
cycles of 95°C for 10 s, 50 °C for 1 min, and 72°C for 30s. Each reaction was carried out in
56
triplicate in 96-well plates; for each biological replicate three technical replicates were also
added. Products of the cDNA synthesis reactions lacking reverse transcriptase (no reverse
transcriptase control; NRT) and reactions with no cDNA template (no template control; NTC)
were also included. The fold change expression of PR1a, PR1b and Pin II in ASM treated
samples relative to corresponding water treated controls was calculated and presented in Figure
3-3; 3-4 and 3-5.
Statistical Analysis
All the greenhouse experiments and gene expression studies were set up in a completely
randomized design (CRD) in the greenhouse. The percentage DS data from greenhouse trials and
fold change expression data from qRT-PCR experiment were subjected to analysis of variance
(ANOVA) using SPSS software version V22. Mean separation was analyzed using Fisher’s
Least Significant Difference (LSD) at P=0.05.
Results
Greenhouse Experiments
In all of the trials, untreated BHN 602 control had significantly high DS than any of the
treatments in resistant rootstock, BHN 998 (Table 3-1). A significant reduction in disease
severity of BHN 602 was obtained with drench ASM treatment as compared to the foliar treated
or untreated control (Table 3-1; Figure 3-1) (P =0.05). There was no statistical difference
between the DS of untreated BHN 602 control and BHN 602 applied with ASM as foliar spray
(Table 3-1; Figure 3-1). BHN 998 showed wilting symptoms in only one of the greenhouse trials
(Trial 2) at 7 days post inoculation (dpi), out of the two trials (Trial 2 and Trial 3) (Table 3-1). In
Trial 2, where wilting was observed, BHN 998 with drench ASM application had significantly
reduced DS relative to untreated BHN 998 control (Table 3-1; Figure 3-2). Foliar ASM applied
BHN 998, however, had disease severity numerically intermediate between drench treated and
57
untreated BHN 998 control and statistically not different from either of the two (Table 3-1;
Figure 3-2).
ASM Mediated Effect on Expression of PR1a, PR1b and Pin II in Tomato Root and Leaf
In this study, the effect of ASM application method (foliar and drench) on the expression
of PR1a, PR1b and Pin II in the leaves and root of bacterial wilt susceptible tomato cultivar,
BHN 602, were studied (Figure 3-3; 3-4 and 3-5).
There was no significant difference in the expression of PR1a between foliar treated and
drench treated tomato root at any sampling point (24, 48 and 72 hours post ASM application).
However, there was a significant difference in the expression of PR1a between and within foliar
and drench treated tomato leaves (Figure 3-3). In the foliar ASM treated leaves, expression of
PR1a was highest at 24-hour post application, which dropped significantly at 48 hour, and 72-
hour post application (Figure 3-3). In the drench ASM treated leaves, highest induction of PR1a
occurred at 48 hour, which was significantly higher than the expression at 24 hour but
statistically comparable to the expression at 72 hour (Figure 3-3). The expression of PR1a in
tomato leaf 24 hour after foliar ASM application was significantly higher than PR1a expression
in any of the other root or leaf treatments (Figure 3-3). Comparing the expression of PR1a in leaf
and root, foliar ASM treated leaf (at 24 hour) and drench ASM treated leaf (at 48 hour) had
significantly high expression than any of the root treatments (Figure 3-3).
There was no statistical difference in the expression of PR1b between foliar ASM treated
tomato root, drench ASM treated tomato root and drench ASM treated tomato leaf at any
sampling point (24, 48 and 72 hours post ASM application) (Figure 3-4). However, the relative
expression of PR1b in tomato leaf at 24 and 48 hours after foliar ASM application was
significantly higher than in any of the other root or leaf treatments (Figure 3-4).
58
There was no statistical difference in the expression of Pin II between foliar ASM treated
tomato leaf, drench ASM treated tomato leaf and foliar ASM treated tomato root at any sampling
point (24, 48 and 72 hours post ASM application) (Figure 3-5). Interesting, drench ASM applied
tomato root showed significant induction of Pin II at 24 hours post application compared to Pin
II expression in all the other root and leaf treatments treated with ASM as foliar spray or as soil
drench (Figure 3-5).
Discussion
The study demonstrated the feasibility of greenhouse management of bacterial wilt
disease of susceptible tomato cultivar, BHN 602, using drench ASM treatment. Foliar ASM
treatment, on the other hand was statistically similar to untreated control. This was in accordance
with the speculation that ASM mediated induction of SA and ET signaling might at least
compensate for the pathogen (R. solanacearum) mediated suppression of SA and ET in tomato,
demonstrated by Milling et al. 2011, and thus reduce bacterial wilt disease symptoms. Graham et
al (2013) and Huang et al (2011), demonstrated drench application of ASM was more effective
than foliar application in controlling citrus canker and bacterial spot of tomato. The gradual
release and prolonged persistence of the active metabolite during drench ASM treatment as
opposed to shorter persistence of the metabolite during foliar application (Buonaurio et al. 2002;
Myresiotis et al. 2014; Scarponi et al. 2001) has been proposed to explain longer systemic
protection against by drench ASM application as reported by Graham et al. (2013) and Huang et
al. (2011) and possibly against bacterial wilt disease of BHN 602 as observed in this study.
In the greenhouse trials, more disease severity was seen in both the susceptible (BHN
602) and (BHN 998) resistant tomato genotypes in Trial 2 (conducted in fall) than in Trial 3
(conducted in spring). In fact, no wilting was observed in any of the BHN 998 treatments in Trial
3 at 7 dpi. Both of these trials (Trial 2 and 3) were conducted in Gainesville, FL under natural
59
sunlight conditions. The environmental conditions during spring (cold weather and shorter
daylight), which is relatively unfavorable for the survival of tropic strain (Rs5) of R.
solanacearum, might have caused more disease in untreated BHN 602 and BHN 998 in Trial 2
than in Trial 3. Although no symptoms were observed in any of the BHN 998 treatments at 7 dpi
in Trial 3, the symptoms became evident at 12 dpi (data not shown). A separate statistical
analysis of the DS data of BHN 998 in Trial 3 at 12 dpi showed a significant reduction in DS
with drench ASM treatment and foliar application was statistically similar to both drench treated
and untreated BHN 998 control. This was in consistence to the DS data of BHN 998 obtained in
Trial 2 at 7dpi. The results therefore indicate the possibility of integrating drench ASM
application with grafting, for strengthening the defense response of resistant rootstock against
bacterial wilt disease of tomato. The field trials are currently in progress to evaluate the efficacy
of drench ASM treatment to control bacterial wilt disease in non-grafted (BHN 602) and grafted
(BHN 602 grafted onto BHN 998) tomatoes in open field production.
R. solanacearum, being a soil-borne disease, the speculation in the study was that the
reduction of disease symptom with drench ASM treatment as opposed to foliar treatment might
be related to a comparatively higher defense induction in tomato root, locally applied with
chemical (drench) than low root induction during distal (foliar) application. However, the
expression of PR1a (and also of PR1b) did not differ significantly in tomato roots, irrespective of
the application method, foliar and drench. Interestingly, expression of Pin II (JA pathway) was
significantly induced in the root of drench ASM treated tomato (at 24 hour) relative to that in
root of foliar ASM treated tomato. In this scenario, it is likely that the substantial up-regulation
of Pin II in tomato root following drench ASM treatment has role in bacterial wilt symptom
reduction. Further research is, however, necessary to confirm the significance of ASM mediated
60
induction of Pin II in tomato root defense against bacterial wilt disease. Also, it is important to
consider that in this study, ASM mediated kinetics of only three of the PR genes in tomato roots
were studied. Insights derived from the expression profiling of three PR genes as presented here,
might not be enough to understand the overall mechanism. Further, it is also possible that PR
genes distinct from the ones studied here might be important in tomato root defense signaling
against R. solanacearum. A more comprehensive microarray analysis could reveal global tomato
root transcriptional response to drench versus foliar ASM application. As per our literature
search, this is the first report comparing defense kinetics of three key defense pathways (SA, ET
and JA pathways) in tomato leaves and roots following foliar versus drip application of ASM in
greenhouse conditions. The striking difference in the relative expression of PR1a and PR1b
between tomato root and leaf following ASM application as foliar spray and soil drench,
strengthens the notion that the defense signaling in root and leaf of plants are different and under
different regulatory controls.
Compared to the substantial increase in the relative expression of PR1a (307.37 fold) and
PR1b (208.17 fold) in tomato leaf by foliar ASM application, the relative expression of Pin II in
foliar ASM treated tomato leaf was comparatively lower (2.11 fold). This was in consistent with
the previous studies by Baysal et al. 2003 and Herman et al. 2007 who demonstrated ASM
mediated induction of SA and ET defense pathways in tomato leaf with no effect on JA defense
pathway. Similarly, the relative expression of both PR1a and PR1b in tomato leaves was
significantly high at 24 hour after foliar ASM application than in any of the drench treatments (at
any sampling time). This could be attributed to the higher concentration of the active metabolite
in locally applied leaf tissue (at 24 hour post foliar ASM application) versus lower concentration
resulting from distal (drench) root application. Supporting this hypothesis, Buonaurio et al. 2002
61
and Scarponi et al. 2001 reported higher concentration of ASM and/or its active metabolite at
locally applied leaves of tomato and pepper compared to distal leaves which were located further
from site of application.
Huang et al (2011), in an effort to control bacterial wilt of tomato, reported a significantly
greater marketable yield 27.3 % with drip ASM treatment (at concentration ranging 0.25-0.50
oz/A) compared to foliar ASM spray (at different rates and frequencies). Several other studies
have reported a significant yield loss with foliar ASM treatment, a phenomenon known as yield
drag (Graham et al. 2013; Louws et al. 2001; Romero et al, 2001). The reduction in the growth
and yield caused by the intense use of foliar ASM has been attributed to the physiological
compensation against excessive and constitutive induction of plant defense (van Loon et al.
2006; Walters and Fountaine, 2009). In accordance to this, a significant induction of SA and ET
defense signaling was observed in foliar ASM applied tomato leaves (at 24 hour post
application) than in any of the tomato leaves applied with ASM as soil drench.
In this study, the effect of the ASM application method (foliar and drench) on the
expression of key defense pathways in roots and leaves of BHN 602 (bacterial wilt susceptible
cultivar), was investigated. Similar study on effect of foliar and drench application of ASM on
the defense signaling of resistant rootstock will be conducted in future. The information obtained
from the study will help in planning the optimal strategy of ASM application for targeting
multiple foliar and soil-borne diseases in open field tomato production.
62
Table 3-1. Bacterial wilt disease severity (DS) (%) of susceptible cultivar ‘BHN 602’ and
resistant rootstock ‘BHN 998’ in the greenhouse following foliar and drench
applications of Acibenzolar-S-Methyl (ASM).
Entry Bacterial wilt DS (%)
(Trial 1)
Bacterial wilt DS (%)
(Trial 2)
Bacterial wilt DS (%)
(Trial 3)
BHN 602 untreated
control
91.67a1 86.36a 65.63a
BHN 602 + ASM
(foliar)
83.33a
70.45a 46.88a
BHN 602 + ASM
(drench)
33.33b 13.64bc 21.88b
BHN 998 untreated
control
- 34.00b 0.00c
BHN 998 + ASM
(foliar)
- 29.54bc 0.00c
BHN 998 + ASM
(drench)
- 2.27c 0.00c
All the trials were arranged as a randomized complete block design. Trial 1, Trial 2 and Trial 3 consisted of three,
eleven and eight replications/treatment respectively.
In all the trials, ASM (0.5 mg/L) was applied twice, either as foliar spray or as soil drench, at a seven days interval.
Two days after second ASM application, 50 mL of R. solanacearum (107CFU/mL) was poured on the base of each
plants following root wounding and DS (%) was calculated seven days after bacterial inoculation. 1Column means followed by the same letter are not significantly different at P ≤ 0.05 based on Least Significant
Difference (LSD).
63
A
B
C
Figure 3-1. Reduction of bacterial wilt disease symptoms in drench ASM treated susceptible
tomato cultivar (BHN 602) compared to foliar treated and untreated control following
inoculation with 107 CFU/mL of R. solanacearum with root wounding. A) BHN 602
untreated control, B) BHN 602 with foliar ASM treatment and C) BHN 602 with
drench ASM treatment.
64
A
B
C
Figure 3-2. Reduction of bacterial wilt disease symptom in drench ASM treated resistant
rootstock (BHN 998) compared to untreated control, following inoculation with 107
CFU/mL of R. solanacearum with root wounding. A) BHN 998 untreated control, B)
BHN 998 with foliar ASM treatment and C) BHN 998 with drench ASM treatment.
65
Figure 3-3. Mean fold induction of PR1a in the leaf and root tissues of bacterial wilt susceptible
cultivar (BHN 602) at 24, 48 and 72 hours post ASM application relative to the
corresponding water treated controls. ASM was applied either as foliar spray or as
soil drench. Standard error of mean (SEM) was calculated with three replications of
each treatment. Bars with the same letters do not differ significantly according to
Fisher’s Least Significant Difference (LSD) at P=0.05.
a
b
d d
bc
cd
d d d d d d
0
50
100
150
200
250
300
24 hr 48 hr 72 hr 24 hr 48 hr 72 hr 24 hr 48 hr 72 hr 24 hr 48 hr 72 hr
Foliar Drench Foliar Drench
Leaf Root
Fold
chan
ge
66
Figure 3-4. Mean fold induction of PR1b in the leaf and root tissues of bacterial wilt susceptible
cultivar (BHN 602) at 24, 48 and 72 hours post ASM application relative to the
corresponding water treated controls. ASM was applied either as foliar spray or as
soil drench. Standard error of mean (SEM) was calculated with three replications of
each treatment. Bars with the same letters do not differ significantly according to
Fisher’s Least Significant Difference (LSD) at P=0.05.
a
b
c
c
c c
c c c c c c 0
100
200
300
400
24 hr 48 hr 72 hr 24 hr 48 hr 72 hr 24 hr 48 hr 72 hr 24 hr 48 hr 72 hr
Foliar Drench Foliar Drench
Leaf Root
Fold
chan
ge
67
Figure 3-5. Mean fold induction of Pin II in the leaf and root tissues of bacterial wilt susceptible
cultivar (BHN 602) at 24, 48 and 72 hours post ASM application relative to the
corresponding water treated controls. ASM was applied either as foliar spray or as
soil drench. Standard error of mean (SEM) was calculated with three replications of
each treatment. Bars with the same letters do not differ significantly according to
Fisher’s Least Significant Difference (LSD) at P=0.05.
b b b b
ab
b b b
b
a
b b
0
2
4
6
8
10
12
24 hr 48 hr 72 hr 24 hr 48 hr 72 hr 24 hr 48 hr 72 hr 24 hr 48 hr 72 hr
Foliar Drench Foliar Drench
Leaf Root
Fold
chan
ge
68
CHAPTER 4
INTEGRATING GRAFTING AND APPLICATION OF SYSTEMIC ACQUIRED
RESISTANCE INDUCER FOR FIELD MANAGEMENT OF BACTERIAL WILT DISEASE
OF TOMATO
Introduction
Tomato (Solanum lycopersicon) is an important vegetable crop in the United States. The
total production of fresh market tomato in the U.S. is 1,249,280 tonnes harvested from 93,600
acres of land with a farm value of $1.11 billion (USDA- NASS, 2014). Florida, being one of the
largest fresh market tomato producing states in the U.S., contributed 36.64% of the total
production in 2013 (USDA- NASS, 2014) and had a farm value of $0.46 billion (USDA- NASS,
2014). Open field tomato production in the southeastern United States, including Florida, is
highly affected by bacterial wilt disease caused by Ralstonia solanacearum (R. solanacearum)
(Ji et al. 2005; Hong et al. 2012). R. solanacearum is a soil-borne bacterium belonging to β
subdivision of Proteobacteria. Major crop losses due to the disease have been reported from
almost all of the tomato producing regions of the world (Hayward 1991, 1994). The bacterium
has a wide host range of more than 450 plant species in 54 different families (Hayward et al.
1991) and was listed as the second most important bacterial plant pathogen in the world
(Mansfield et al. 2012). In Florida, race I (biovar I, phylotype II) has been reported to cause more
than 80% yield loss in open field tomato production under disease favorable conditions (Hong et
al. 2012).
Soil fumigation with fumigants such as methyl bromide and/or chloropicrin was
commonly used for managing many of the soil-borne diseases including R. solanacearum, root-
knot nematodes, and weeds (Denny, 2006; Enfinger et al. 1979; Ishii and Aragaki, 1963; Ji et al.
2005; Santos et al. 2006; Thoquet et al. 1996). Methyl bromide is a broad-spectrum biocide that
is injected into the soil as a liquid. Once in soil it subsequently vaporizes filling soil air space.
69
However, since the establishment of Montreal Protocol (UNEP 2011), methyl bromide has been
phased out, because of its ozone depleting activity (Santos et al. 2006). Field application rates
have been reduced and now methyl bromide use is only allowed under critical use exemptions
(King et al. 2008). Also, chloropicrin remains under strict regulation of the United States
Environmental Protection Agency (EPA) because of the toxic and volatile nature (Gan et al.
2000). Few of the plant derived volatile essential oils like thymol (obtained from Thyme
(Thymus spp.)), palmarosa (obtained from Cymbopogan martini), and lemon grass oils were
found effective against Rs5 (race 1, biovar 1) in the tomato field (Ji et al. 2005; Pradhanang et al.
2005). However, the volatile nature, low soil retention, difficult field application method and
high cost associated with these plant essential oils renders them infeasible for practical
application in the field. Crop rotation is particularly effective against races that exhibit narrow
host range like race 3 on potato but for races that exhibit wider host range like race 1, effect of
crop rotation is minimal (McCarter, 1991). This is particularly true for Florida, as race 1 is
endemic. In the past, rye (for winter) and sorghum-sudan (for summer) were recommended as
suitable rotation and cover crops for managing race 1 in North Florida (Momol et al. 2005).
However, since the weed host range of R. solanacearum is extensive (Janse et al. 2004;
Pradhanang et al. 2000; Wenneker et al. 1999), effective management is difficult with crop
rotation. So far, use of the resistant cultivars has been universally identified as the most effective
and practical method for managing bacterial wilt disease (Boshou 2005; Boshou et al. 2005;
Lebeau et al. 2011). However, grower and industry preferences are still intact for many varieties
that do not have resistance to bacterial wilt, but are commercially popular due to other
horticultural traits, like better fruit qualities.
70
Grafting as a technique to manage soil borne diseases has only recently gained popularity
in the U.S. for bacterial wilt management. Several of the studies conducted in the U.S. have
demonstrated the effectiveness of grafting to manage bacterial wilt disease in open field tomato
production using either the open-pollinated breeding lines (Lin et al. 2008; Rivard et al. 2008) or
using hybrid rootstocks (McAvoy et al. 2012). A significant increase in tomato yield has also
been observed with grafting (McAvoy et al. 2012). Apart from grafting, foliar applications of
SAR inducers like Acibenzolar-S-Methyl (ASM; Syngenta Crop Protection, Inc. Greensboro,
NC. U.S.A) have also been shown to provide effective disease control in moderately resistant
genotypes but not on susceptible cultivars (Pradhanang et al. 2005). Few studies in the past have
demonstrated that the soil application of SAR inducers provide better and persistent disease
control as compared to foliar treatment (Graham et al. 2011). In this scenario, it would be
interesting to see if drip application of ASM in the field, instead of foliar, would give better
control of bacterial wilt disease in susceptible tomato cultivar. Apart from this, integrating ASM
application with other currently available control methods like grafting may open up new
avenues for better management of bacterial wilt disease of tomato.
This study was undertaken to determine if integrating grafting with ASM application
improves field management of bacterial wilt disease in open field tomato production. The
objectives of this study were i) to compare the efficacy of foliar and drip applications of ASM
for field management of bacterial wilt disease in susceptible cultivar and ii) to investigate the
effectiveness of integrating grafting with ASM treatment for controlling bacterial wilt disease of
tomato in the field.
71
Materials and Methods
Bacterial Culture and Inoculum Preparation
R. solanacearum tomato strain (race 1, biovar 1, phylotype II, sequevar 7) isolated from
infected tomato in Quincy, FL was used in the study (Ji et al. 2005, 2007). A pure culture of Rs5
was streaked on casamino acid peptone glucose (CPG) agar medium (Kelman, 1954), incubated
at 28°C for 48 hours and confirmed in the plate with Immunostrips (Agdia, Inc. Elkhart, IN).
Bacterial suspension of the culture was then prepared in sterile deionized water and adjusted
spectrophotometrically to OD600 = 0.1 corresponding to ~108 colony forming units /milliliter
(CFU/mL). The suspension so prepared was further diluted to 105 or 10
6 CFU/mL in sterile
deionized water and used for field inoculations.
Field Trials
Three field trials were conducted at North Florida Research and Education Center,
Quincy, FL. during the fall of 2012, 2013 and 2014 to evaluate the efficacy of integrating
grafting and ASM application for field management of bacterial wilt disease of tomato. All the
grafted treatments consisted of the bacterial wilt susceptible tomato cultivar, BHN 602, grafted
onto the resistant rootstock, BHN 998. The self-grafted treatment consisted of BHN 602 grafted
onto itself. In 2012 trial, there were five total treatments; self-grafted BHN 602, non-grafted
BHN 602, non-grafted BHN 602 treated with foliar ASM, untreated grafted control and grafted
plants treated with foliar ASM (Table 4-1). In addition to these treatments in the 2012 trial
(excluding self-grafted treatment), two more treatments were added in 2013 and 2014 trials that
includes drip ASM application given to both grafted and non-grafted BHN 602 in addition to
respective foliar treatments (Table 4-2 and Table 4-3).
Seeds of BHN 998 and BHN 602 were sown in the peat vermiculite mixture (Metro
mix®, Sun Gro Horticulture Canada Ltd, Agawam, MA) and allowed to germinate in expanded
72
polystyrene trays (4.4 × 4.4 × 6.3 cm) under natural sunlight condition inside a green-house with
temperatures of 24-28°C (day) and 18-23°C (night). Two weeks after seedling emergence,
grafting was done using a modified Japanese tube graft technique (Rivard et al. 2006). All the
grafting was done early in the morning to prevent high temperature and water stress to the
grafted plants. Also, to prevent the rootstock regrowth and subsequent need of pruning, all
grafting was done below the rootstock cotyledon. Immediately following grafting, the grafted
transplants were kept inside a healing chamber with high humidity to let the graft union heal.
The grafted transplants were put under complete darkness inside the healing chamber and
allowed to heal for 7-10 days. Transplants were then removed from the healing chamber and
placed in the greenhouse bench for 10-14 days. In all of the trials, single greenhouse application
of ASM (50 mg/l) was given to the transplants, 10-15 days after taking them out of the grafting
chamber, followed by weekly application in the field after transplantation. In the greenhouse,
ASM application was done either as foliar spray (sprayed onto the lower and upper leaf surface
with a handheld sprayer until runoff) or as soil drench (10 mL of solution poured at the base of
the each plant) followed by weekly application in the field. In the field, foliar ASM was applied
using backpack CO2 powered sprayer (adjusted to 60 psi) fitted with a boom to apply a 1-m
band with 0.5 oz/A. Drip ASM application in the field was also conducted at 0.5 oz/A rate.
Field inoculation for the 2012 trial was done by pouring 50 mL of 106 CFU/mL of Rs5
strain suspended in deionized water in each planting holes 5 days before transplanting. The
plants were transplanted to the field on Aug-9 that was one day after initial greenhouse ASM
application. The first field ASM treatment for this trial was given on Aug-16 following four
more weekly applications on Aug-23, Aug-31, Sept-6 and Sept-14. Each treatment in the 2012
trial consisted of four replications with fourteen plants in each replication.
73
Field inoculations for both 2013 and 2014 trials were done by pouring 50 mL of 105
CFU/mL of Rs5 strain suspended in field irrigation water in each planting hole. The bacterial
inoculum for field inoculation was dropped by one log unit in 2013 and 2014 field trials than in
2012 trial to prevent extreme pathogen pressure in the field, as R. solanacearum is a good soil
survivor.
Field inoculation in the 2013 trial was done 14 days before transplanting on 19th August
and in 2013 trial field inoculation was done on 8th August that was 7 days before field
transplanting. For both of the trials, field transplanting was 2 days after greenhouse ASM
treatment. Each treatment in 2013 trial consisted of four replications with 17 plants in each
replication and each treatment in 2014 trial consisted of four replications with 14 plants in each
replication. The first field ASM treatment for 2013 trial was done on Aug-22 followed by three
more weekly applications on Aug-28, Sept-6 and Sept-13. In 2014 trial, the first field ASM
treatment was done on Aug-12 followed by four more weekly applications on Aug-19, Aug-26,
Sept-2 and Sept-8.
The field plots were arranged in a raised bed with bed dimensions 12.7 cm (tall) × 76.2
cm (wide) and spaced 1.8 m apart and plants were spaced 50.8 cm within the row. The field soil
was Norfolk sandy loam type (Thermic Typic Kandiudults) with pH 6.3. Beds were fumigated
with chloropicrin (50%) and methyl bromide (50%) at a rate of 280 kg a.i./ha and covered with
white polyethylene mulch following application of inorganic fertilizers as based on soil test
results and cooperative extension recommendations (Olson et al. 2011). In each of the trials,
before the bacterial inoculation and after the transplantation, the plots were irrigated to field
capacity via the drip irrigation line established underneath the polyethylene mulch. Bacterial wilt
incidence data for each of the plots were recorded at weekly intervals, which were quantified as
74
the percentage of plants wilted. A disease progression curve representing the weekly wilt
incidence for each treatment in each year has been shown in Figure 4-1; 4-2; and 4-3. Tomato
fruits were harvested on Nov-1 and Nov-18, respectively, in the 2012 and 2013 field trial.
Marketable yield of tomato fruits in these years was recorded at harvest and graded to USDA
standard size as extra-large, large and medium as depicted in Table 4-1, 4-2 and 4-3.
Statistical Analysis
All the field trials were arranged as a randomized complete block design (CRBD). The
statistical analysis of disease incidence and yield data of 2012 and 2013 trials were done with
SAS (Version 9.1; SAS Institute Inc. Cary, NC), using Least Significant Difference (LSD). In
2014 trial, one of the plots in drip ASM treated grafted treatment had significant number of
plants with scion rooting, and was thus excluded from the analysis. The disease incidence value
for this plot was replaced using Expected Maximization (EM) algorithm of SPSS software
version V22. Subsequently the disease incidence data of 2014 was also analyzed using SPSS
software version V22.
Results
In all field trials conducted for three subsequent years, grafting significantly reduced the
bacterial wilt disease and significantly improved yield of tomato plants, as compared to the non-
grafted susceptible control (Table 4-1, 4-2 and 4-3) (Figure 4-1, 4-2 and 4-3).
In 2012 trial, no significant difference in the disease incidence and total yield was
observed between untreated and foliar treated non-grafted BHN 602 (Table 4-1; Figure 4-1).
However, in the grafted scenario, the total yield was significantly reduced by foliar ASM
application relative to untreated grafted control. However, no significant difference in the disease
incidence was evident between the two treatments. Both the grafted treatments, either foliar
treated or untreated, showed significantly reduced disease incidence and improved yield than any
75
of the non-grafted treatments. The disease incidence and yield response of self-grafted BHN 602
was statistically similar to the non-grafted BHN 602.
In 2013 trial, similar to that in 2012, no significant difference in the disease incidence
was observed in the foliar ASM treated non-grafted plants relative to the untreated control (Table
4-2; Figure 4-2). A reduction in yield was also observed in non-grafted foliar ASM treated BHN
602 as compared to the untreated control. In the grafted scenario foliar ASM treatment neither
helped to reduce disease incidence nor improved yield of the grafted plants. Interestingly, the
total yield of grafted plants treated with foliar ASM remained statistically similar to non-grafted
control. Drip ASM treatment, in the non-grafted scenario provided a significant reduction of the
disease incidence relative to the untreated control. Despite, no significant effect on total yield
was evident. Although, no wilting symptoms were evident in the drip ASM treated grafted
plants, the disease incidence and total yield of this treatment was statistically similar to that of
corresponding values in untreated grafted control. Interesting, total yield of drip ASM treated
grafted plant, however, was significantly greater than foliar ASM treated grafted plant, although
the disease incidence of the two treatments remained statistically similar.
In 2014 trial, there was no significant difference between the disease incidences of non-
grafted BHN 602 and non-grafted BHN 602 treated with ASM either as foliar or drip application
(Table 4-3; Figure 4-3). Also, disease incidences of grafted BHN 602 and grafted BHN 602
treated with ASM was statistically similar, irrespective of the ASM application method.
Interestingly, the amount of disease control obtained with drip ASM treated in non-grafted BHN
602 was statistically similar to that in BHN 602 grafted onto resistant rootstock.
Discussion
In the field trials conducted over three years in the study, a significant reduction in the
bacterial wilt incidence was obtained with grafting which confirms the effectiveness of grafting
76
for effective management of bacterial wilt of tomato as evident in many previous studies (Lin et
al. 2008; McAvoy et al. 2012; Rivard et al. 2008). Furthermore, the ability of grafting to
significantly increase yield in susceptible tomato line as demonstrated in previous studies was
also evident in this study (Table 4-1, 4-2 and 4-3). In the 2012 trial (which was the only trial
having self-grafted control) the self-grafted treatment was statistically similar to the non-grafted
control, indicating grafting itself did not have any effect on the disease incidence or fruit yield
response (Table 4-1; Figure 4-1). This has been observed in a number of our previous studies.
Anith et al. (2004) demonstrated ASM mediated control of bacterial wilt disease in
greenhouse grown susceptible tomato cultivar at low bacterial concentration (<106 CFU/mL).
Moreover, in the field experiment, foliar application of ASM was shown to effectively reduce the
bacterial wilt disease in the moderately resistant tomato cultivars; however, no significant effect
in the susceptible cultivar was evident (Pradhanang et al. 2005). This was in consistence to our
result; the disease severity of foliar ASM treatment was statistically similar to untreated control
as observed in all of the field trials conducted for three years in the study (Table 4-1; 4-2 and 4-
3; Figure 4-1; 4-2; 4-3). However, in contrast to the failure of the foliar-applied ASM to
significantly reduce bacterial wilt of susceptible tomato cultivars, drip application of ASM was
found to significantly reduce bacterial wilt incidence of susceptible tomato cultivar in 2013 trial
(Table 4-2; Figure 4-2). In 2014, however, no statistical difference in the disease incidence was
observed between drip ASM treated and untreated control (Table 4-3; Figure 4-3). Interestingly,
in both 2013 and 2014 field trials in which drip ASM treatment were included, disease incidence
of the non-grafted BHN 602, treated with drip ASM, exhibited disease incidence statistically
similar to that of grafted control, meaning drip ASM treatment given to the susceptible cultivar
could itself be as effective as grafting in controlling the bacterial wilt disease of tomato (Table 4-
77
2 and 4-3). Drip ASM mediated control of bacterial wilt disease in susceptible tomato cultivar
was predicted from the multiple greenhouse studies conducted over the past two years. The
comparatively longer persistence of the compound in the soil, when applied as soil drip, versus
substantial loss during foliar runoff presumably led to continuous release of the compound and
gradual root uptake leading to longer systemic translocation and thus longer defense induction
during soil application versus shorter induction during foliar application. Similar hypothesis was
also indicated in the study by Graham (2011) that demonstrated soil application of SAR inducer
to give better control of citrus canker in young grapefruit trees than foliar application. Relevant
phenomenon of gradual uptake and progressive translocation with root application of SAR
inducers have been studied extensively in the past (Sur and Stork 2003). In context to this,
Myresiotis et al. 2014 reported the detection of ASM and its active metabolite in tomato at one
hour following drench ASM application. The highest concentration was observed at 24 and 48
hours which remained detectable till the last sampling point of 240 hours post application. Foliar
treatment of ASM, instead was reported to form acid metabolite within two hours post
application in tomato plant in separate study by Scarponi et al. 2001 with no residue detected 72
hours post application. Also increased expression of PR genes during soil application of ASM
resulting in greater and longer systemic protection than foliar spray was further demonstrated by
Graham and Leite 2007 and Francis et al. 2009. A separate study conducted by us also
demonstrated persistent induction of SAR related PR gene in the leaves of drip ASM treated
tomato leaf versus shorter induction in foliar ASM treated leaves (data unpublished), which
might explain the significant reduction in bacterial wilt disease observed in BHN 602 with drip
treatment in 2013 trial versus no effect obtained with foliar treatment (Table 4-2; Figure 4-2).
78
Studies in the past have reported a significant yield loss with foliar application of ASM in
tomato (at a concentration of 35 g. ai/ha) and pepper (at a concentration of 17 or 35 g. ai/ha), a
phenomenon usually known as yield drag (Louws et al. 2001; Romero et al. 2001). Consistent to
this, in 2012 trial, we observed a significant reduction in yield in foliar ASM applied grafted
plants relative to untreated control (Table 4-1). Also in the 2013 trial, foliar application of ASM
to grafted plant resulted in a significant reduction in yield as compared to grafted plant, which
received drip ASM treatment (Table 4-2). The reduction in the growth and yield caused by the
intense use of foliar ASM has been attributed to the physiological compensation against
excessive and constitutive induction of plant defense (van Loon et al. 2006; Walters and
Fountaine 2009).
Apart from bacterial wilt, grafting has been shown to be effective against several other
important soil-borne diseases of tomatoes in the U.S. These include root-knot nematodes
(Meloidogyne spp.) (Kunwar et al. 2014; Rivard et al. 2010), southern blight (Sclerotium rolfsii)
(Rivard et al. 2010), Fusarium wilt (Fusarium oxysporum f.sp. lycopersici) and Verticillium wilt
(Verticillium dahlia) (Louws et al. 2010; Rivard et al. 2006). Furthermore, ASM mediated
control of bacterial spot (caused by Xanthomonas axonopodis pv.vesicatoria) and bacterial speck
(caused by Pseudomonas syringae pv. tomato) of tomato have even been shown in the past
(Louws et al. 2001). A future study on the effectiveness of the integrated approach combining
grafting with SAR inducer, has been planned that will test the profitability of this approach in
tomato production by effective control of multiple pathogens in the open field tomato
production.
79
Table 4-1. Fruit yield (kg/ha) and percentage bacterial wilt (BW) incidence of tomato cultivar
‘BHN 602’ grafted onto resistant rootstock ‘BHN 998’ integrated with foliar
application of ASM (0.5 oz/A). The trial was conducted in fall 2012 in Quincy, FL
Entry Medium Large Extra Large Total BW incidence (%)
Grafted 3,383 az 4,117 a 10,284 a 17,784 a 11.9 b
Grafted + ASM (foliar) 2,522 a 2,244 b 5,768 b 10,535 b 28.0 b
Self - grafted 207 b 93 c 0 c 300 c 88.9 a
Non - grafted 448 b 352 c 165 c 966 c 87.5 a
Non - grafted + ASM
(foliar)
492 b 346 c 278 c 1,116 c 73.9 a
LSD (0.05) 1,228 725.1 3,723.60 4,969.30 26.582
P>F 0.0002 <0.0001 <0.0001 <0.0001 <0.0001 Each entry consisted of 4 replications with 14 plants in each replication, and the experiment was arranged as a
randomized complete block design.
Field was inoculated with R. solanacearum (Rs5) strain with 50 mL of 106 CFU/mL in each planting hole 5 days
before field transplanting. zColumn means followed by the same letter are not significantly different at P ≤ 0.05 based on Least Significant
Difference (LSD).
80
Table 4-2. Fruit yield (kg/ha) and percentage bacterial wilt (BW) incidence of tomato cultivar
‘BHN 602’ grafted onto resistant rootstock ‘BHN 998’ integrated with foliar and drip
application of ASM (0.5 oz/A). The trial was conducted in fall 2013 in Quincy, FL
Entry Medium Large Extra Large Total BW incidence (%)
Grafted 5,936 az 8,686 ab 23,762 a 38,384 ab 6.3 bc
Grafted + ASM (foliar) 4,003 ab 5,855 bc 13,098 a 22,956 bc 13.8 bc
Grafted + ASM (drip) 6,562 a 10,491 a 23,658 a 40,710 a 0.0 c
Non - grafted 4,687 ab 3,762 c 8,963 b 17, 412 c 55.2 a
Non - grafted + ASM
(foliar)
2,277 b 2,217 c 3,043 b 7,537 c 29.8 ab
Non - grafted + ASM
(drip)
4,737 a 5,045 bc 8,700 b 18,483 c 17.0 bc
LSD (0.05) 3,067.90 4,621.50 11,287 17,450 26.2
P>F 0.1085 0.0138 0.0047 0.0057 0 yEach entry consisted of 4 replications with 17 plants in each replication, and the experiment was arranged as a
randomized complete block design. yField was inoculated with R. solanacearum (Rs5) strain with 50 mL of 10
5 CFU/mL in each planting hole 14 days
before field transplanting. zColumn means followed by the same letter are not significantly different at P ≤ 0.05 based on Least Significant
Difference (LSD).
81
Table 4-3. Percentage bacterial wilt (BW) incidence of tomato cultivar ‘BHN 602’ grafted onto
resistant rootstock ‘BHN 998’ integrated with foliar and drip application of ASM (0.5
oz/A). The trial was conducted in fall 2014 in Quincy, FL.
Entryx BW incidence
y (%)
Grafted 35.5 cz
Grafted + ASM (foliar) 29.4 c
Grafted + ASM (drip) 30.3 bc
Non - grafted 76.5 ab
Non - grafted + ASM (foliar) 80.4 a
Non - grafted + ASM (drip) 68.4 a yEach entry consisted of 4 replications with 14 plants in each replication, and the experiment was arranged as a
randomized complete block design. yField was inoculated with R. solanacearum (Rs5) strain with 50 mL of 10
5 CFU/mL in each planting hole 7 days
before field transplanting. zColumn means followed by the same letter are not significantly different at P ≤ 0.05 based on Least Significant
Difference (LSD).
82
Figure 4-1. Progression of bacterial wilt incidence of tomato cultivar ‘BHN 602’ grafted onto
resistant rootstock ‘BHN 998’ integrated with foliar application of ASM (0.5 oz/A).
The trial was conducted in fall 2012 in Quincy, FL.
0
10
20
30
40
50
60
70
80
90
100
21-A
ug
28-A
ug
4-S
ep
11-S
ep
18-S
ep
25-S
ep
2-O
ct
9-O
ct
16-O
ct
23-O
ct
Dis
ease
in
cid
ence
BHN 602
BHN 602 + actigard (foliar)
BHN 602 self- grafted
Grafted
Grafted + actigard (foliar)
BHN 998
83
Figure 4-2. Progression of bacterial wilt incidence of tomato cultivar ‘BHN 602’ grafted onto
resistant rootstock ‘BHN 998’ integrated with foliar and drip application of ASM (0.5
oz/A). The trial was conducted in fall 2013 in Quincy, FL.
0
10
20
30
40
50
60D
isea
se i
nci
den
ce
BHN602
BHN602 + actigard (foliar)
BHN602 + Actigard (drip)
Grafted
Grafted + actigard (foliar)
Grafted + Actigard (drip)
84
Figure 4-3. Progression of bacterial wilt incidence of tomato cultivar ‘BHN 602’ grafted onto
resistant rootstock ‘BHN 998’ integrated with foliar and drip application of ASM (0.5
oz/A). The trial was conducted in fall 2014 in Quincy, FL.
0
10
20
30
40
50
60
70
80
90D
isea
se i
nci
den
ce BHN602
BHN602 + actigard (foliar)
BHN602 + Actigard (drip)
Grafted
Grafted + actigard (foliar)
Grafted + Actigard (drip)
85
CHAPTER 5
SUMMARY AND CONCLUSION
Bacterial wilt disease of tomato caused by Ralstonia solanacearum (Smith 1986) (R.
solanacearum) is one of the major constraints in fresh market tomato production in southeastern
United States including Florida. Major crop losses due to the disease have been reported from
almost all of the tomato producing regions of the world. Currently, the use of the resistant
rootstocks for grafting is the most effective method of controlling the disease. Thus,
development of resistant rootstocks has been the main focus in bacterial wilt management. In this
study, twenty-eight hybrid tomato rootstocks were screened in the greenhouse conditions for
resistance against R. solanacearum. The results revealed three hybrids rootstocks WG12-110,
WG12-120 and WG12-140 (all derived from H7997, a highly stable bacterial wilt resistant
source) are highly resistant as no disease symptoms were noted throughout the experiment
period. Assessment of the bacterial colonization in the crown region of these resistant hybrids
revealed high bacterial population (~107
CFU/mL) that was statistically similar to resistant
rootstocks BHN 998 and H7997. Our result therefore supports the emerging notion that
resistance in tomato encompasses host’s ability to adapt to a latent bacterial colonization as
described by (Lebeau et al. 2011). The high bacterial concentration (107 CFU/mL) used in the
experiment is not typical of the actual population occurring in the field and may overwhelm the
defense mechanism of some hybrids. Therefore the results obtained in our greenhouse study may
not reflect the level of resistance as would be expressed under natural field conditions. Therefore,
further field trials are necessary before using these hybrids rootstocks for grafting against
bacterial wilt disease.
There are currently no effective bactericides against bacterial wilt. However, in contrast
to the conventional pesticides, systemic acquired resistance (SAR) inducers like Acibenzolar-S-
86
methyl (ASM; Syngenta Crop Protection Inc. Greensboro, NC) do not exhibit direct
antimicrobial activity. Therefore, they provide disease control without exerting any selection
pressure on pathogen population, which prevents the risk of developing resistant strains. This
also holds true for grafting which is recently gaining popularity in U.S. against multiple tomato
diseases. In this study, multiple greenhouse studies and field trials were conducted in Florida
from 2012-2014 to determine the integrated effect of grafting and application of ASM for
controlling bacterial wilt disease of tomato. In greenhouse experiments, ASM (50 mg/l) was
applied twice either as foliar spray or as soil drench before bacterial inoculation. Soil application
of ASM significantly reduced disease severity on a susceptible tomato cultivar (BHN 602) and
resistant rootstock (BHN 998) relative to untreated control. In contrast foliar treatment remained
statistically similar to untreated control (P=0.05). In the field, a single drench application of
ASM (50 mg/l) before transplanting followed by weekly drip applications (0.5 oz/A) after
transplanting also reduced bacterial wilt incidence in BHN 602 in both the field trials, with one
of them being statistically significant to the untreated control (P=0.0045). However, no
substantial improvement in yield was evident in BHN 602 with the drip ASM treatment
(P=0.0057). In contrast to soil ASM treatment that provided significant disease control in the
greenhouse and field conditions, foliar ASM treatment exhibited no significant difference in the
disease severity and yield of susceptible cultivar (BHN 602) in any of the experiments, relative
to untreated control. The comparatively longer persistence of ASM during soil application as
compared to substantial loss during foliar runoff presumably led to continuous release and
gradual root uptake leading to longer systemic translocation and thus constitutive defense
induction. In agreement to this, relatively longer expression of salicylic acid pathway markers
and ethylene pathway marker (PR1a and PR1b) was observed in drench ASM treated tomato leaf
87
than in foliar ASM treated tomato leaf (each relative to corresponding water treated controls).
This prolonged persistence of the defense induction might explain the better disease control
obtained with soil ASM treatment in both greenhouse and field studies as compared to the
corresponding foliar treatment.
Grafting (BHN 998 rootstock and BHN 602 scion) alone and grafting combined with drip
ASM treatment (0.5 oz/A) did not differ statistically in controlling the disease and improving
yield. However, both the treatments provided significantly better disease control and yield
relative to the untreated control. In contrast, foliar ASM application combined with grafting
provided a marginal (statistically non-significant but numerically consistent) increase in disease
incidence and statistically reduced yield in one of the field trials as compared to the untreated
grafted control (P<0.0001). Also, in our gene expression study relatively higher intensity of
expression of PR1a and PR1b were observed in foliar treated tomato leaf than in drench ASM
treated tomato leaf (both relative to corresponding water treated controls). Both the yield
reduction and relatively higher fold PR gene expression as observed with foliar ASM treatment
indicates the physiological compensation against excessive defense described in many other
studies (Romero et al. 2001; van Loon et al. 2006; Walters and Fountaine 2009).
Grafting has been previously shown to control multiple tomato diseases like root-knot
nematodes (Meloidogyne spp.) (Kunwar et al. 2014; Rivard et al. 2010), southern blight
(Sclerotium rolfsii) (Rivard et al. 2010), Fusarium wilt (Fusarium oxysporum f.sp. lycopersici)
and Verticillium wilt (Verticillium dahliae) (Louws et al. 2010; Rivard et al. 2006). Apart from
bacterial wilt, bacterial spot of tomato caused by Xanthomonas spp. is another detrimental
disease of tomato worldwide and is also common in Florida. ASM mediated control of bacterial
spot (Xanthomonas axonopodis pv. vesicatoria) and bacterial speck (Pseudomonas syringae pv.
88
tomato) of tomato have also been well demonstrated (Louws et al. 2001). In this scenario the
potential benefit of integrating grafting and ASM application for multiple pathogen control will
be studied in open field tomato production, in future.
89
LIST OF REFERENCES
Abdullah, H. 1992. Bacterial wilt in Malaysia: Hosts, disease incidence and geographical
distribution. ACIAR Proc. 45:334-337.
Acosta, J. C., Gilbert, J. C., Quinon, V. L. 1964. Heritability of bacterial wilt resistance in
tomato. Proceedings of the American Society of Horticulture Science. 84:455-462.
Adhikari, T.B. and Basnyat, R.C. 1998. Effect of crop rotation and cultivar resistance on
bacterial wilt of tomato in Nepal. Can. J. Plant Pathol. 20: 283-287.
Aglika, E. 2005. Pathogenesis-related proteins: Research progress in the last 15 years. General
and Applied Plant Physiology 31:105-124.
Akiew, E., and Trevorrow, P. R.1994. Management of bacterial wilt of tobacco. Pages 179-198
in: Bacterial Wilt: The Disease and its Causative Agent, Pseudomonas solanacearum, A.
C. Hayward and G. L. Hartman, eds. CAB International,Wallingford.
Alvarez, A.M. 2005. Diversity and diagnosis of Ralstonia solanacearum. Pages 437–448 in:
Bacterial wilt disease and the Ralstonia solanacearum species complex, eds. Allen C.
Prior P. Hayward A.C. APS Press, St. Paul, MN
Anais, G. 1986. Utilisation de la resistance varietale dans la lutte contre le fletrissement bacterien
de la tomate dO a Pseudomonas solanacearum E. F. Smith. In: Ministere de I'
Agriculture, ed. Bulletin Technique d'Information, Paris, 409-411:449-453.
Anand, N., Sadashiva, A., Tikoo, T., Ramkishun, S. K., and Reddy, K. M. 1993. Resistance to
Bacterial Wilt in Tomato: Gene Dosage Effects in Bacterial wilt in: Hartman G.L.
Hayward A.C. (Ed.) Bacterial Wilt. ACIAR Proceedings: 45.
Andrews, P. K., and Marquez. C. S.1993. Graft incompatibility. Horticultural reviews. 15:183-
232.
Anith, K. N., Momol, M. T., Kloepper, J. W., Marois, J. J., Olson S. M., and Jones, J. B. 2004.
Efficacy of plant growth-promoting rhizobacteria, acibenzolar-S-methyl, and soil
amendment for integrated management of bacterial wilt on tomato. Plant Disease.
88:669-673.
Arnold, M.H., and Brown, S. J. 1968.Variation in the host parasite relationship of a crop disease.
Journal of Agricultural Science. 71:19-36
Barrett, C.E., Zhao, X., and Hodges, A.W. 2012. Cost Benefit Analysis of Using Grafted
Transplants for Root-knot Nematode Management in Organic Heirloom Tomato
Production. Horttechnology. 22:252-257.
Block, A., Schmelz, E., O’Donnell, P. J., Jones, J.B., and Klee, H. J. 2005. Systemic acquired
tolerance to virulent bacterial pathogens in tomato. Plant Physiol. 138:1481–1490.
90
Boshou, L. 2008. A broad Review and Perspective on Breeding for Resistance to Bacterial Wilt.
Pages 225 – 238: in Bacterial Wilt Disease and the Ralstonia solanacearum Species
Complex. C. Allen, P. Prior and A.C. Hayward eds. The American Phytopathology
Soceity Press, St. Paul, MN, U.S.A.
Boshou, L., Liang X. Q., Jiang, H. F., Lei, Y., Shan, Z. H., and Zhang, X. Y. 2005. Progress on
genetic enhancement for resistance to groundnut bacterial wilt in China. Pages 239–246
in: C. Allen, P. Prior and A.C. Hayward eds. The American Phytopathology Soceity
Press, St. Paul, MN, U.S.A.
Buddenhagen, I., and Kelman, A. 1964. Biological and physiological aspects of bacterial wilt
caused by Pseudomonas solanacearum. Annu.Rev. Phytopathol. 2:203-230.
Buddenhagen, I. W., Sequeira, L., and Kelman, A. (1962) Designation of races of Pseudomonas
solanacearum. Phytopathology. 52:726.
Buonaurio, R., Scarponi, L., Ferrara, M., Sidoti, P., Bertona, A. 2002. Induction of Systemic
Acquired Resistance in Pepper Plants by Acibenzolar-S-methyl against Bacterial Spot
Disease. European Journal of Plant Pathology 108(1):41-49
Champoiseau, P. G., Jones, J. B., and Allen, C. 2009. Ralstonia solanacearum race 3 biovar 2
causes tropical losses and temperate anxieties. Plant Health progress (doi: 10.1094/PHP-
2009-0313-01-RV).
Champoiseau, P.G. 2008. USDA NRI Project: R. solanacearum race 3 biovar 2: detection,
exclusion and analysis of Select Agent Educational modules. Reviewers: Allen, C. Jones,
J.B. Momol, T.
Chellemi, D. O., Dankers, H. A., Olson S. M., Hodge N. C., and Scott, J. W.1964. Evaluating
Bacterial Wilt-resistant Tomato Genotypes Using a Regional Approach. J Amer. Soc.
Hort. Sci. 119(2):325–329.
Chellemi, D.O., Olson, S.M., and Scott, J.W. 1994. Field Evaluation of tomato genotypes for
resistance to bacterial wilt. Proc. Fla. State Hort. Soc. 107:151-153.
Cook, D. R., Barlow, E., and Sequeira, L. 1989. Genetic diversity of Pseudomonas
solanacearum: Detection of restriction fragment polymorphisms with DNA probes that
specify virulence and hypersensitive response. Mol. Plant-Microbe Interact. 2:113-121.
Daughtrey, M. 2003. Southern bacterial wilt, caused by Ralstonia solanacearum. Society of
American Florists’ 19th Annual Conference on Insect and Disease Management on
Ornamentals.
Daughtrey, M. 2003. New and re-emerging diseases in 2003. Department of Plant Pathology,
Cornell University, Long Island Horticultural Research & Extension Center.
Denny, T. P. 2000. Ralstonia solanacearum. A plant pathology in touch with its host. Trinds
Microbiol. 8:486-489.
91
Denny, T. P. 2006. Plant Pathogenic Ralstonia Species. Pages 573-644 in: Plant-Associated
Bacteria, Gnanamanickam, S.S. eds. Springer Publishing, Dordrecht, The Netherlands.
Denny, T. P., and Hayward, A.C. 2001. Ralstonia solanacearum. Pages 151-173 in: Laboratory
Guide for Identification of Plant Pathogenic Bacteria. Schaad, N.W. Jones J.B. and W.
Chun, eds. The American Phytopathology Soceity Press, St. Paul, MN, U.S.A.
Dhital, S. P., Thaveechai, N., Kositratana, W., Piluek, K., and Shrestha, S.K. 1997. Effect of
chemical and soil amendement for the control of bacterial wilt of potato in Nepal caused
by Ralstonia solanacearum. Kasetsart Journal of Natural Science. 31:497-509.
Digat, B., and Derieux, M.1968. A study of the varietal resistance of tomato to bacterial wilt II.
The practival value of F1 hybrids and their contribution to the genetic basis of resistance.
Proceedings of 6th Annual Meeting Caribbean Food Crops Society. 85-100.
Dong, X. 1998. SA, JA, ethylene, and disease resistance in plants. Current Opinion in Plant
Biology 1:316-323.
Durrant, W. E., and Dong, X. 2004 Systemic acquired resistance. Annu Rev Phytopathol.
42:185-209
Elphinston, J. G., Stanford, H. M., and Stead, D. E. 1998. Detection of Ralstonia solanacearum
in potato tubers, Solanum dulcamara, and associated irrigation waters. Pages 133-139 in
Bacterial wilt disease: Molecular and Ecological Aspects. Prior P, Allen C and
Elphinstone J, eds. Springer Verlag, Berlin.
Elphinstone, J. G. 2005. The current bacterial wilt situation: A global overview. Pages 9-28 in:
Bacterial Wilt: The Disease and the Ralstonia solanacearum Species Complex. C. Allen,
P. Prior, and A. C. Hayward, eds. American Phytopathological Society, St. Paul, MN.
Elphinstone, J.G., Hennessy, J., Wilson, J.K., Stead, D.E. 1996. Sensitivity of different methods
for the detection of Ralstonia solanacearum in potato tuber extracts. Bull OEPP 26:
663–678.
Enfinger, J. M., McCarter, and S. M., Jaworski, C. A. 1979. Evaluation of chemicals and
application methods for control of bacterial wilt of tomato transplants. J. Phytopathology
69:637-640.
Engelbrecht, M.C. 1994. Modification of a semi-selective medium for the isolation and
quantification of Pseudomonas solanacearum. ACIAR Bacterial Wilt Newsletter.
Englebrecht, M. C. 1994. Modification of a semi-selective medium for the isolation and
quantification of Pseudomonas solanacearum. Pages 3-5 in: Bacterial Wilt Newsletter.
Hayward, A. C, eds. Australian Centre for International Agricultural Research, Canberra,
Australia. European Symposium on Ralstonia.
92
Ephinstone, J. G. 2005. The current bacterial wilt situation: a global overview. Pages 9-28 in:
Bacterial Wilt: The Disease and the Ralstonia solanacearum Species Complex. C. Allen,
P. Prior, and A. C. Hayward, eds. American Phytopathological Society, St. Paul, MN.
Faraq N., Stead D. E., and Janse J. D. 1999. Ralstonia (Pseudomonas) solanacearum race 3
biovar 2 detected in surface (irrigation) water in Egypt. J. Phytopathol. 147: 485-487.
Fegan, M., and Prior, P. 2004. Recent developments in the phylogeny and classification of
Ralstonia solanacearum. Presentation at the 1st International Tomato Symposium.
Orlando, FL.
Fegan, M., and Prior, P. 2005. How complex is the “Ralstonia solanacearum species complex”?
Pages 449-461 in Bacterial Wilt Disease and the Ralstonia solanacearum Species
Complex. C. Allen, P. Prior and A.C. Hayward, eds American Phytopathological Society,
St. Paul, MN.
Fegan, M., and Prior, P. 2006. Bacterial wilts of banana caused by members of the Ralstonia
solanacearum species complex. Australas. Plant Pathol. 35:93-101.
Food and Agriculture Organization of the United Nations, FAOSTAT database (FAOSTAT,
2012) http://faostat.fao.org/site/567/default.aspx#ancor
Francis, P.B., and Stark, R. 2012. Heirloom Tomato Production in Conventional and
Transitional-organic Managed Systems. Hortscience. 47:1034-1037.
Francis, I. M., Redondo, A., Burns, K. J., and Graham, H, J. 2009. Soil application of
imidacloprid and related SAR-inducing compounds produces effective and persistent
control of citrus canker. Eur J Plant Pathol. 124:283–292
Freeman, J., McAvoy, T., Rideout, S., Paret, M. L., and Olson, S. M., 2011. Utilization of
grafted tomato seedlings for bacterial wilt resistance in open field production. Acta
Horticulturae. 914:337-339
French, E. B., Aley. P. G., and Elphinstone, J. 1995. Culture media for Ralstonia solanacearum
isolation, identification and maintenance. Fitopatologia. 30(3):126-130
Gabriel, D. W., Allen, C., Schell, M., Denny, T. P., Greenberg, J. T., Duan, Y. P., Flores-Cruz,
Z., Huang, Q., Clifford, J. M., Presting, G., González, E. T., Reddy, J., Elphinstone, J.
Swanson, J., Yao, J., Mulholland, V., Liu, L., Farmerie, W., Patnaikuni, M., Balogh, B.,
Norman, D., Alvarez, A., Castillo, J. A., Jones, J. B., Saddler, G., Walunas, T., Zhukov,
A., and Mikhailova, N. 2006. Identification of open reading frames unique to a select
agent: Ralstonia solanacearum race 3 biovar 2. Mol. Plant-Microbe In. 19:69-79.
Gan, J., Yates, S.R., Ernst, F.F., and Jury, W.A. 2000. Degradation and volatilization of the
fumigant chloropicrin after soil treatment. J. Environ. Qual. 29:1391–1397.
Genin, S., and Boucher, C. 2002. Ralstonia solanacearum: secrets of a major pathogen unveiled
by analysis of its genome. Mol. Plant Pathol. 3:111-118.
93
Gilbert, J. C., Tanaka, J. S., and Takeda, K. Y. 1973. ‘Kewalo’ tomato. HortScience. 9:481-482.
Graham, J., Jones, D. A., and Lloyd, A. B. 1979. Survival of Pseudomonas solanacearum race 3
in plant debris and in latently infected potato tubers. Phytopathology 69:1100-1103
Graham, J. H., and Leite, R. P. Jr. 2007. Soil applied neonicotinoids for control of bacterial
diseases on young citrus trees. Page 107 in Proceedings of International Workshop on
PR-Proteins and Induced Resistance Against Pathogens and Insects. Doorn, The
Netherlands.
Graham, J. H., and Myers, M. E. 2011. Soil application of SAR inducers imidacloprid,
thiamethoxam, and acibenzolar-S-methyl for citrus canker control in young grapefruit
trees. Plant Dis. 95:725-728.
Graham, J. H., and Myers, M. E. 2013. Integration of soil applied neonicotinoid insecticides and
acibenzolar-S-methyl for systemic acquired resistance (SAR) control of citrus canker on
young citrus trees. Crop protection 54:239-243
Graham, J., and Lloyd, A. B. 1979. Survival of potato strain (race 3) of Pseudomonas
solanacearum in the deeper soil layers. Pages 489-496 in: Australian Journal of
Agricultural Research 30(3).
Granada, G. A., Sequeira, L. 1983. Survival of Pseudomonas solanacearum in soil, rhizosphere,
and plant roots. Canadian Journal of Microbiology 29:433-440
Grey, B. E., and Steck, T. R. 2001. The viable but nonculturable state of Ralstonia
solanacearum may be involved in long-term survival and plant infection.
Grimault, V., Prior, P. 1993. Bacterial wilt resistance in tomato associated with tolerance of
vascular tissues to Pseudomonas solanacearum. Plant Pathol. 42:589-594.
Grimault, V., Prior, P., and Anais, G. 1995. A monogenic dominant resistance of tomato to
bacterila wilt in Hawaii 7996 is associated with plant colonization by Pseudomonas
solanacearum. J. Phytopatho. 143:349-352.
Jiang, H., Liao, B. X., Ren, X., Lei, Y., Mace, E., Fu, T., and Crouch, J. H. 2007. Comparative
assessment of genetic diversity of peanut (Arachis hypogaea L.) genotypes with various
levels of resistance to bacterial wilt through SSR and AFLP analyses,” Journal of
Genetics and Genomics 34 (6):544–554.
Hanson, P. M., Wang, J. F., Licardo, O., Hanudin, O, L., Mah, S. Y., Hartman, G. L., Lin, Y.C.,
and Chen, J. T. 1996. Variable reaction of tomato lines to bacterial wilt evaluated at
several locations in Southeast Asia. HortScience 31:143-146.
Hanson, P. M., Hanudin, O. L., Wang, J. F., and Chen, J. T. 1998. Diallel analysis of bacterial
wilt resistance in tomato derived from different sources. Plant Dis. 82:74-78.
94
Harrison, D. J., and P.G. Burges. 1962. Use of rootstock resistance for controlling Fusarium wilt
of tomatoes. Plant Pathol. 11:23-25.
Hayward, A. 1994. Systematics and phylogeny of Pseudomonas solanacearum and related
bacteria. Pages 127-135 in: Bacterial wilt: the disease and its causative agent,
Pseudomonas solanacearum. G. L. Hartman and A. C. Hayward, eds. CAB International,
Oxford, England.
Hayward, A. C. 1964. Characteristics of Pseudomonas solanacearum. J. Appl. Bacteriol. 27:265-
277.
Hayward, A. C. 1991. Biology and epidemiology of bacterial wilt caused by Pseudomonas
solanacearum. Annu. Rev. Phytopathol. 29:65-87.
Hayward, A. C. 1994. The host of Pseudomonas solanacearum. Pages 9-24 in: Bacterial Wilt:
The disease and its causative agent, Pseudomonas solanacearum. A. C. Hayward and G.
L. Hartman, eds. CAB International, Wallingford, U.K.
Hayward, A.C. 1991. Biology and epidemiology of bacterila wilt caused by Pseudomonas
solanacearum. Annual Review of Phytopathology 29:65-87.
Hayward, A.C., Sequeira, L., French, E., R. El-Nashaar H. M. and Nydegger, U. 1992. Tropical
variant of Biovar 2 of Pseudomonas solanacearum. Phytopathology 82:608 (abstr).
He, L.Y., Sequeira, L., and Kelman, A. 1983. Characteristics of strains of Pseudomonas
solanacearum. Plant. Dis. 67:1357-1361
Heiser, C.T. 1969. "Night shades, the Paradoxical Plant. Freemen press. 53-105. San Francisco.
Califorlia, U.S.A.
Henderson, W.R., and Jenkins, S. F. Jr. 1972. ‘Venus’ and ‘Saturn’ tomato varieties resistant to
southern bacterial wilt. HortScience 7:346.
Herman, M., Restrep, S., and Smart, C.D. 2007. Defense gene expression patterns of three SAR-
induced tomato cultivars in the field. Physiological and Molecular Plant Pathology 71:
192–200
Hong, J.C. Momol, M. T. Jones, J. B. Ji, P. S. Olson, S. M. Allen, C. Perez, A. Prakash, P. and
Guven, K. 2008. Detection of Ralstonia solanacearum in irrigation ponds and aquatic
weeds associated with the ponds in North Florida. Plant Disease 92(12):1674-1682.
Hong, J.C., Norman, D. J., Reed, D. L., Momol, M. T., and Jones, J. B. 2012. Diversity among
Ralstonia solanacearum strains isolated from the southeastern United States.
Phytopathology, 102(10):924-936.
Huang, C. H., Vallad, G. E., Zhang, S., Wen, A. B., B. and Figueredo, J. F. L. 2012. Effect of
application frequency and reduced rates of acibenzolar-S-methyl on the field efficacy of
induced resistance against bacterial spot on tomato. Plant Dis. 96:221–227.
95
Huang, C. H., and Vallad, G. E. 2011. Foliar versus soil applications of ASM for bacterial spot
management on tomato. Plant Disease Management Report.
Ishii, M., and Aragaki, M. 1963. Ginger wilt caused by Pseudomonas solanacearum E.F. Smith.
Plant Dis. Report 47:710–713.
Jackobs, M. J., Babujee, L., Meng, Fanhong., Milling, A., and Allen, C. 2011. The In Planta
Transcriptome of Ralstonia solanacearum: Conserved Physiological and Virulence
Strategies during Bacterial Wilt of Tomato. mBio 3(4): 1-11
Janse, J. D., Van den Beld, H. E., Elphinstone, J., Simpkins, S., Tjou-Tam-Sin, N. N. A., and
Van Vaerenbergh, J. 2004. Introduction to Europe of Ralstonia solanacearum biovar 2,
race 3 in Pelargonium zonale cuttings. J. Plant Pathol. 86:147-155.
Janse, J. D. 1999. Ralstonia (Pseudomonas) solanacearum race 3 (biovar 2) in surface water and
natural weed hosts: First report on stinging nettle (Urtica dioica). European Journal of
Plant Pathology 105: 307-315
Jaworski, C. A., Phatak, S. C., Gate, S. R., Gitaitis, R. D., Widrlechner, M. P. 1987. GA 1565-2-
4 BWT, GA 219-1-2 BWT, GA 1095-1-4 BWT, GA 1405-1-2 BWT bacterial wilt-
tolerant tomato. HortScience 22:324-325.
Ji, P., Allen, C., Sanchez-Perez, A., Yao, J., Elphinstone, J. G., Jones, J. B., Momol, M. T. 2007.
New diversity of Ralstonia solanacearum strains associated with vegetable and
ornamental crops in Florida. Plant Dis. 91:195-203.
Ji, P., Momol, M. T., Olson, S. M., Pradhanang, P. M., and Jones, J. B. 2005. Evaluation of
thymol as biofumigant for control of bacterial wilt of tomato under field conditions. Plant
Dis. 89:497-500.
Jones, J. B. 2008. Tomato Plant Culture. In the Field, Greenhouse, and Home Garden. Page 1
2nd ed. CRC Press, Taylor and Francis Group, Boca Raton - London - New York
Kachroo, A., Kachroo, P. 2007. Salicylic acid-, Jasmonic acid- and Ethylene- mediated
regulation of plant defense signaling. Volume 28 in Genetic Engineering. J. K. Setlow,
ed. Springer Science + Business Media, LLC.
Kamer, F. M., and Joseph, J. H. 1989. Histoacryl: its use in aesthetic facial plastic surgery.
Archives of Otolaryngology—Head & Neck Surgery 115(2):193.
Kelman, A. 1953. The bacterial wilt caused by Pseudomonas solanacearum: A literature review
and bibliography. North Carolina Agric. Exp. Station Tech. Bull. 99: 194-194.
Kelman, A. 1954. The relationship of pathogenicity of Pseudomonas solanacearum to colony
appearance in a tetrazolium medium. Phytopathology 44: 693-695.
King, S. R., Davis A. R., Liu, W., and Levi, A. 2008. Grafting for Disease Resistance.
HortScience 43(6): 1673- 1676.
96
King, S. R., Davis, A. R., Zhang, X., and Crosby, K. 2010. Genetics, breeding and selection of
rootstocks for Solanaceae and Cucurbitaceae. Scientia horticulturae 127(2): 106-111
Ku´c, J. 1982. Induced immunity to plant diseases. BioScience 32:854–860
Kubota, C. 2008. Use of grafted seedlings for vegetable production in North America. Acta Hort.
770:21–28.
Kunwar, S., Paret, M. L., Olson, S. M., Ritchie, L., Rich, J., Freeman, J. H., and McAvoy, T.
2014. Grafting using rootstocks with resistance to Ralstonia solanacearum against
Meloidogyne incognita in tomato production Plant Disease (In Press).
Kunz, W., Schurter, R., and Maetzke, T. 1997. The chemistry of benzothiadiazole plant
activators. Pesticide Science 50:275–282
Lebeau, A., Daunay, M. C., Frary, A., Palloix, P., Wang, J. F., Dintinger, J., Chiroleu, F.,
Wicker, E., and Prior, P. 2011. Bacterial wilt resistance in tomato, pepper, and eggplant:
genetic resources respond to diverse strains in the Ralstonia solanacearum species
complex. Phytopathology 101: 154–165.
Lee, J. M. 2003. Advances in vegetable grafting. Chronica Horticulturae 43:13-19.
Lee, J. M., Kubota, C., Tsao, S. J., Bie, Z., Hoyos, E. P., Morra L., Oda, M. 2010. Current status
of vegetable grafting: Diffusion, grafting techniques, automation. Scientia Horticulturae
127:93-105.
Leggat, P. A., Kedjarune, U., Smith, D.R. 2004. Toxicity of cyanoacrylate adhesives and their
occupational impacts for dental staff. Ind. Health 42(2):207-211.
Lelliott, R.A., and Stead, D.E. 1987. Methods for the diagnosis of bacterial diseases of plants. In:
Methods in Plant Pathology, Vol. 2. T.F. Preece Series, British Society of Plant
Pathology, Blackwell Scientific Publications, Oxford.
Liao, B. S. 2005. A broad review and perspective on breeding for resistance to bacterial wilt.
Pages 225-238 in: Bacterial Wilt Disease and the Ralstonia solanacearum Species
Complex. The American Phytopathology Soceity Press, St. Paul, MN, U.S.A.
Liao, B. S., Liang, X. Q., Jiang, H. F., Lei, Y., Shan, Z. H., Zhang, X. Y. Progress on genetic
enhancement for resistance to groundnut bacterial wilt in China. 2005. Pages 239–246 in:
Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. American
Phytopathological Society Press, St. Paul, MN, U.S.A.
Lima, V. L. A. G., Méloa, E. A., MacielA, M. I. S., Prazeresa, F. G., Musserb, R. S., Limac, D.
E. S. 2005. Total phenolic and carotenoid contents in acerola genotypes harvested at three
ripening stages. Food Chem. 90:565–568
97
Lin, C. H., Hsu, S. T., Tzeng, K. C., and Wang, J. F. 2008. Application of a preliminary screen to
select locally adapted resistant rootstock and soil amendment for integrated management
of tomato bacterial wilt in Taiwan. Plant Disease. 92(6):909-916.
Liu, H., Wang, S., Yu, X., Yu, J., He, X., Zhang, S., Shou, H., and Wu, P. 2005. ARL1, a LOB‐domain protein required for adventitious root formation in rice. Plant J. 43:47-56.
Liu, H., Zhang, S., Schell, M. A., and Denny, T. P. 2005. Pyramiding unmarked deletions in
Ralstonia solanacearum shows that secreted proteins in addition to plant cell-wall-
degrading enzymes contribute to virulence. Mol. Plant Microbe Interact. 18:1296–1305.
Louws, F. J., Rivard, C. L., and Kubota, C. 2010. Grafting fruiting vegetables to manage soil-
borne pathogens, foliar pathogens, arthropods and weeds. Scientia Horticulturae
127(2):127-146.
Louws, F. J., Wilson, M., Campbell, H. L., Cuppels, D. A., Jones, J. B., Shoemaker, P. B., Sahin,
F., and Miller, S.A. 2001. Field control of bacterial spot and bacterial speck of tomato
using a plant activator. Plant Disease 85:481-488.
M´etraux, J., Ahl-Goy, P., Staub, T., Speich, J., Steinemann, A., Ryals, J., and Ward, E. 1991.
Induced systemic resistance in cucumber in response to 2,6-dichloroisonicotinic acid and
pathogens In H. Hennecke, and D. P. S. Verma, eds. Advances in Molecular Genetics of
Plant–Microbe Interactions, vol. 1. Dordrecht: Kluwer Academic Publishers.432–439
Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M.,
Verdier, V., Beer, S.V., Machado, M.A., Toth, I., Salmond, G., and Foster, G.D. 2012.
Top 10 plant pathogenic bacteria in Molecular Plant Pathology 13 (1464-6722): 614-629.
Marco-Noales, E., Bertolini, E., Morente, C., and López, M. M. 2008. Integrated approach for
detection of nonculturable cells of Ralstonia solanacearum in asymptomatic
Pelargonium spp. cuttings. Phytopathology 98(8): 949-955.
McAvoy, T., Freeman, J., Rideout, S., Olson, S. M., and Paret, M. L. 2012. Grafting using
hybrid rootstocks for management of bacterial wilt in field tomato production.
HortScience 47(5):621-625.
McCarter, S. M. 1991. Bacterial wilt. Compendium of tomato diseases. Jones, J. B. Jones, J. P.
Stall, R. E. and Zitter, T. A. Pages 28-29 eds. American Phytopathological Society Press,
St. Paul, MN, U.S.A.
McDowell, J. M., and Dangl, J. L. 2000. Signal transduction in the plant immune response.
Trends Biochem Sci. 25:79–82.
McGarvey, J. A., Bell, C. J., Denny, T. P., and Schell, M. A. 1998. Analysis of extracellular
polysaccharide I in culture and in planta using immunological methods: New insights and
implications Pages 157-163 in: Bacterial Wilt Disease: Molecular and Ecological
Aspects. P. Prior, C. Allen, and J. Elphinstone, eds. Springer, New York.
98
McGarvey, J.A. Denny, T.P. and Schell, M.A. (1999). Spatial-Temporal and Quantitative
Analysis of Growth and EPS I Production by Ralstonia solanacearum in Resistant and
Susceptible Tomato Cultivars. Bacteriology 89(12):1233- 1239.
Milling, A., Babujee, L., and Allen, C. 2011.Ralstonia solanacearum Extracellular
Polysaccharide Is a Specific Elicitor of Defense Responses in Wilt-Resistant Tomato
Plants. PLoS ONE 6(1):e15853.
Milling, A., Meng, F., Denny, T. P., and Allen, C. 2009. Interactions with hosts at cool
temperatures, not cold tolerance, explain the unique epidemiology of Ralstonia
solanacearum race 3 biovar 2. Phytopathology 99:1127–1134.
Momol, T., Ji, P., Jones, J. B., and Olson, S. 2005. Recommended Management Strategies for
Bacterial Wilt on Tomato Caused by Ralstonia solanacearum. NFREC Extension Report
No: 2005-8
Murata, J., and Ohara, K. 1936. Prevention of watermelon fusarium wilt by grafting Lagenaria
Jpn. J. Phytopathol. 6:183–189.
Myresiotis, K. C., Vryzas, Z., and Papadopoulou-Mourkidou, E. 2014. Enhanced root uptake of
acibenzolar-S-methyl (ASM) by tomato plants inoculated with selected Bacillus plant
growth-promoting rhizobacteria (PGPR). Applied soil ecology (77):26-33.
Nakaho, K., Inoue, H., Takayama, T., and Miyagawa, H. 2004. Distribution and multiplication of
Ralstonia solanacearum in tomato plants with resistance derived from different origins.
Journal of General Plant Pathology 70:115–9.
National Ag Statistics Service, USDA, 2013 from http://www.nass.usda.gov/
Nesmith W. C., and Jenkins S. F. Jr, 1985. Influence of antagonists and controlled matric
potential on the survival of Pseudomonas solanacearum in four North Carolina soils.
Phytopathology, 75(11):1182-1187
Nesmith, W. C., and Jenkins, S. F. 1983. Survival of Pseudomonas solanacearum in selected
North Carolina soils. Phytopathology 73:1300-1304.
Novartis Crop Protection. 1999. ASM, a new and novel plant health product for protection
against diseases of agronomic, vegetable and tree crops. Novartis Crop Protection Tech.
Bull. 4.
Oda, M. 1995. New grafting methods for fruit-bearing vegetable s in japan. Japan Agricultural
Research Quarterly 29:187-194.
Oda, M. 1999. Grafting of vegetable to improve greenhouse production. College of Agriculture:
Osaka Prefecture University.
Oda, M. 2002. Grafting of vegetable crops. Sci. Rep. Agr. & Biol. Sci. Osaka Pref. Univ. 54:49-
72
99
Oda, M. 2007. Vegetable seedling grafting in Japan. Acta Hort. 759:175–180
Oda, M. and T. Nakajima. 1992. Adhesive grafting of Chinese cabbage on turnip. HortScience
27: 1136.
OEPP/EPPO Bulletin. 2004. Ralstonia solanacearum, Bulletin 34: 173–178
Oliveira A. B., Moura, C. F. H., Gomes-Filho, E., Marco, C. A., Urban, L., Miranda, R. A. M.
2013. The Impact of Organic Farming on Quality of Tomatoes Is Associated to Increased
Oxidative Stress during Fruit Development. PLoS ONE 8(2):e56354.
Oostendorp, M. W., Kunz, B., Dietrich, B., and Staub, T. 2001. Induced disease resistance in
plants by chemicals. European Journal of Plant Pathology 107:19-28.
Opena, R. T., Hartman, G. L., Chen, J.T., and Yang, C. H. 1990. Breeding for bacterial wilt
resistance in tropical tomato. Pages 44-50 in Prot. Trop. 3rd. Genting Highlands, Pahang,
Malasia.
Opina, N., Tavner, F., Holloway, G., Wang, J. F., Li, T. H., Maghirang, R., Fegan, M., Hayward,
A. C., Krishnapillai, V., Hong, W. F., Holloway, B. W., and Timmis, J. N. 1997. A novel
method for development of species and strain-specific DNA probes and PCR primers for
identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum). Asia-
Pacific Journal of Molecular Biology and Biotechnology 5, 19-30.
Orgambide, G., Montrozier, H., Servin, P., Roussel, J., Trigalet-Demery, D., and Trigalet, A.
1991. High heterogeneity of the exopolysaccharides of Pseudomonas solanacearum
strain GMI1000 and the complete structure of the major polysaccharide. J. Biol. Chem.
266:8312-8321.
Pappu, H. R., Csinos, A. S., McPherson, R. M., Jones, D. C and Stephenson. M. G. 2000. Effect
of acibenzolar-S-methyl and imidacloprid on suppression of tomato spotted wilt
Tospovirus in flue-cured tobacco. Crop Protection 19:349-354.
Paret, M. L., de Silva, A. S., Criley, R. A., and Alvarez, A. M. 2008. Ralstonia solanacearum
Race 4: Risk Assessment for Edible Ginger. HortTechnology 18:90-96.
Park, S.W., Kaimoyo, E., Kumar, D., Mosher, S., and Klessig, D. F. 2007. Methyl salicylate is a
critical mobile signal for plant systemic acquired resistance. Science 318:113-116.
Pastrik, K. H., and Maiss, E. 2000. Detection of Ralstonia solanacearum in potato tubers by
polymerase chain reaction. J. Phytopathol. 148(11- 12):619-626.
Pegg, K. G., and Moffet, M. 1971. Host range of ginger strains of Pseudomonas solanacearum in
Queensland. Australian J. Experimental Ag Anim. Husbandry 11:696-698.
Peralta, I. E., and Spooner, D. M. 2000. Classification of wild tomatoes: a review. Kurtziana
28:45-54.
100
Pieterse, C. M. J. and L. C. Van Loon. 2007. Signaling cascades involved in induced resistance.
Pp. 65-88 in D. Walters, A. Newton, and G. Lyon, eds. Induced resistance for plant
defense: A sustainable approach to crop protection. Oxford,UK: Blackwell Publishing.
Poussier S, Trigalet-Démery D, Vandewalle P, Goffinet B, Luisetti J, Trigalet A (2000) Genetic
diversity of Ralstonia solanacearum as assessed by PCR-RFLP of the hrp gene region,
AFLP and 16S rRNA sequence analysis, and identification of an African subdivision.
Microbiology 146:1679–1692
Pozo, M. J. L. C. Van Loon, C. M. J. Pieterse. 2005. Jasmonates – signals in plantmicrobe
interactions. Journal of Plant Growth Regulation 23:211-222.
Pradhanang, P. M., Elphinstone, J. G. and Fox, R. T. V. 2000. Identification of crop and weed
hosts of Ralstonia solanacearum biovar 2 in the hills of Nepal. Plant Pathology 49: 403-
413.
Pradhanang, P. M., Ji, P., Momol, M. T., Olson, S. M., Mayfield, J. L. and J. B. Jones. 2005.
Application of acibenzolar-S-methyl enhances host resistance in tomato against Ralstonia
solanacearum. Plant Disease 89:989-993.
Prior, P. Grimault, V. and Schmit. J. 1994. Resistance to bacterial wilt (Pseudomonas
solanacearum) in tomato: Present status and prospects, p. 209-223. In: Bacterial Wilt:
The disease and its causative agent, Pseudomonas solanacearum. A. C. Hayward and G.
L. Hartman, eds. CAB International, Wallingford, U.K.
Rajan, S. and Peter, K.V. 1986. Incomplete dominance of bacterial wilt resistance. Report
Tomato Genetics Cooperative, 36,24.
Rick, C.M. (1973). Potential genetic resources in tomato species: Clues from observations in
native habitats. p. 255-269. In: A.M. Srb (ed.). Genes, Enzymes and Populations. Plenum
Publishing Corp. NY.
Rick, C.M. (1976). Tomato Lycopersicon esculentum (Solanaceae). p. 268-273. In: N.W.
Simmonds (ed.). Evolution of Crop Plants. Longman, London.
Rick, C.M. (1978). The tomato. Scientific American. 239(2):76-87.
Rick, C.M. and J.F. Fobes. (1975). Allozymes of Galapagos tomatoes: polymorphism,
geographic distribution and affinities. Evolution 29(3):443-457.
Rivard, C. L. 2006. Grafting Tomato to Manage Soilborne Diseases and Improve Yield in
Organic Production Systems. Maters thesis, North Carolina State University, Raleigh,
NC. U.S.A.
Rivard, C. L. 2006. Grafting Tomato to Manage Soilborne Diseases and Improve Yield in
Organic Production Systems. Maters thesis, North Carolina State University, Raleigh,
NC. U.S.A
101
Rivard, C. L., Louws, F. J., 2008. Grafting to manage soilborne diseases in heirloom tomato
production. HortScience 43:2104–2111.
Rivard, C.L., O’Connell, S., Peet, M. M., and Louws, F. J. 2010. Grafting tomato with
interspecific rootstock to manage diseases caused by Sclerotium rolfsii and southern root-
knot nematode. Plant Dis. 94:1015–1021.
Rolfs, P. H. 1898. Diseases of tomato. Fla. Agr. Expt. Stn. Bull. 47:128-136.
Romero, A. M. Kousik, C. S., and D. F. Ritchie. 2001. Resistance to tance by simultaneous
activation of salicylate- and jasmonate- bacterial spot in bell pepper induced by
acibenzolar-S-methyl. Plant dependent defense pathways in Arabidopsis thaliana. Proc.
Natl. Dis. 85:189–194.
Ross, F. A. 1961. Systemic acquired resistance induced by localized virus infection in plants.
Virology 14: 340–358.
Saddler, G. S. 2005. Management of bacterial wilt disease. Pages 121-132 in: Bacterial Wilt: The
Disease and the Ralstonia solanacearum Species Complex. C. Allen, P. Prior, and A. C.
Hayward, eds. The American Phytopathology Soceity Press, St. Paul, MN, U.S.A.
Santos, B. M., Gilreath, J. P., Motis, T. N., Noling, J. W., Jones, J. P., and Norton, J. A. 2006.
Comparing methyl bromide alternatives for soilborne disease, nematode and weed
management in fresh market tomato. Crop Prot. 25:690-695.
Santos, B. M., McAvoy, E. J., Ozores-Hampton, M., Vallad, E. G., Dittmar, J. P., Webb, E. S.,
Smith. A. H., and Olson. M. S. 2014. Tomato production. Pages 161-180 in: Vegatable
Production Handbook for Florida. G. E. Vallad, B. Santhos, ed. IFAS, University of
Florida.
Scarponi, L., Buonaurio, R., and Martinetti, L. 2001. Persistence and translocation of a
benzothiadiazole derivative in tomato plants in relation to systemic acquired resistance
againstPseudomonas syringae pv tomato. Pest. Manag. Sci. 57:262–268.
Schell, M. A. 2000. Control of virulence and pathogenicity genes of Ralstonia solanacearum by
an elaborate sensory network. Annu. Rev. Phytopathology. 38:263-292.
Scott, J. W. Vallad, G. E. Jones, J. B. 2009. High level of resistance to bacterial wilt (Ralstonia
solanacearum) obtained in large-fruited tomato breeding lines derived from Hawaii 7997.
Acta Hortic. 808: 269–274.
Scott, J. W., Wang, J. F., and Hanson, P. M. 2005 Breeding tomatoes for resistance to bacterial
wilt, a global view. Acta Hort. 695:161-172.
Scott, J. W., Somodi, G. C. and Jones, J. B. 1993. Testing tomato genotypes and breeding for
resistance to bacterial wilt in Florida. Proc. Intl. Bacterial Wilt Symp. Kaoshiung,
Taiwan.
102
Seal, S. E. 1998. Molecular methods for detection and discrimination of Ralstonia
solanacearum. Pages 103-109o in: Bacterial Wilt: the Disease and it Causative Agent
Pseudomonas solanacearum ed. Hayward, A.C and Hartman, G.L.. CABI International,
UK.
Shew, H. D., and Lucas, G.B. 1991. Compendium of Tobacco Diseases. American
Phytopathological Society Press, St. Paul, MN.
Smith, A. F. 1994. The Tomato in America: Early History, Culture, and Cookery. Columbia SC,
USA: University of South Carolina Press. ISBN 1-57003-000-6
Smith, E.F.1896. A bacterial disease of the tomato, eggplant and Irish potato (Bacillus
solanacearum nov. sp.). USDA, Div. Veg Phys & Path Bulletin 12:1–28.
Smith, E.F. 1896. A bacterial disease of tomato, pepper, eggplant and Irish potato (Bacillus
solanaceraum nov. sp.). United States Department of Agriculture, Division of
Agriculture, Division of vegetable Physiology and Pathology Bulletin 12:1-28.
Smith, J.W.M. 1966. A new Tomato Rootstock Seed Parent. Euphytica 15(3):395
Smith, J.W.M. 1968. A New Wilt-Resistant Parent for Producing Tomato Rootstock Seed.
Euphytica 17(3):414.
Soylu, E. M., Soylu, S., and Baysal, Ö. 2003. Induction of disease resistance and antioxidant
enzymes by Acibenzolar-S-Methyl against bacterial canker (Clavibacter michiganensis)
in tomato. Journal of Plant Pathology 85(3):175-181.
Sticher, L., Mauch-Mani B., and Me´traux, J. P. 1997. Systemic acquired resistance. Annu. Rev.
Phytopathol. 35:235–270.
Sullivan, M., Daniells, E., Southwick, C., and Mackesy, D. 2013. CPHST Pest Datasheet for
Ralstonia solanacearum race 3 biovar 2. USDA-APHIS-PPQ-CPHST.
Sur, R., and Stork, A. 2003. Uptake, translocation and metabolism of imidacloprid in plants. Bull
Insectol 56:35–40.
Syngenta Crop Protection. 2001. Revolutionary Product Now Available to Prevent Disease in
California Leafy Vegetables. Plant Health Progress report from
http://www.plantmanagementnetwork.org/pub/php/news/blockade
Tanksley, D. S. 1987. Organization of the nuclear genome in tomato and related diploid species.
The Amer. Naturalist. 546-561.
Taylor, I. B. 1986. Biosystematic of the tomato. Pages 1-34 in: The tomatocrop' a scientific basis
for improvement. I. G. Atherton, I. Rudich, eds.Chapman and Hall, London.
103
Thoquet, P., Olivier, J., Sperisen, C., Rogowsky, P., Prior, P., Anais, G., Mangin, G., Bazin, B.,
Nazer, R., and Grimsley, N. 1996. Polygenic resistance of tomato plants to bacterial wilt
in the French West Indies Mol. Plant-Microbe Interact. 9:837-842.
Tikoo, S. K., Anand, N., and Ram, K. 1983. Presence of two independent genetic systems for
resistance to bacterial wilt (Pseudomonas solanacearum) in tomato. In: Proceedings of
the 15th International Genetic Congress, New Delhi, India.
United States Department of Agriculture, Economic Research Service Report. 2012 from
http://www.ers.usda.gov/topics/crops/vegetables-pulses/tomatoes.aspx#processing
USDA-NASS, 2014. Vegetable s 2013 Summary. USDA, Washington D.C.
Vallad, E. G., and Goodman, M. R. 2004. Systemic Acquired Resistance and Induced Systemic
Resistance in Conventional Agriculture. 44(6):1920-1934
Vallad, G., Pernezny, K., and Momol, T. 2004. A series on diseases in the Florida vegetable
garden: tomato. University of Florida Plant Pathology Department and IFAS Fact Sheet.
PP-200 from http://edis.ifas.ufl.edu/pp121#FOOTNOTE_1
van Der Wolf J. M., Vriend, S. G. C., Kastelein, P., Nijhuis, E. H., van Bekkum, P. J., van
Vuurde, J. W. L. 2000. Immunofluorescence colony-staining (IFC) for detection and
quantification of Ralstonia (Pseudomonas) solanacearum biovar 2 (race 3) in soil and
verification of positive results by PCR and dilution plating. European Journal of Plant
Pathology 106:123–33.
Van Elsas, J. D., Kastelein, P., van Bekkum, P., van der Wolf, J. M., de Vries, P. M., van
Overbeek, L. S. 2000. Survival of Ralstonia solanacearum biovar 2, the causative agent
of potato brown rot, in field and microcosm soils in temperate climates. Phytopathology
90: 1338-1366.
Van Elsas, J. D., Kastelein, P., de Bries, P.M., and van Overbeek, L.S. 2001. Effects of
ecological factors on the survival and physiology of Ralstonia solanacearum bv.2 in
irrigation water. Canadian Journal of Microbiology 47:842–854.
Van Loon, L. C., Rep, M., and Pieterse, C. M. J. 2006. Significance of inducible defense-related
proteins in infected plants. Annual Review of Phytopathology 44:135-162.
Van Loon, L. C., and Van Kammen, A. 1970. Polyacrylamide disc electrophoresis of the soluble
leaf proteins from Nicotiana tabacum var. "Samsun" and "Samsun NN".II. Changes in
protein constitution after infection with Tobacco mosaic virus.Virology. 40:190–211.
Vasse, J., Frey, P., and Trigalet, A. 1995. Microscopic studies of intercellular infection and
protoxylem invasion of tomato roots by Pseudomonas solanacearum. Mol Plant Microbe
In. 8:241–251.
Verma, R. K., Shekhawat, G. S., 1991.Effect of crop rotation and chemical soil treatment on
bacterial wilt of potato. Indian Phytopathology 44(1):5-8
104
Villareal, R. L. and Lal, S. H. 1978. Reaction of three tomato cultivars-their F1’s and three way
crosses to two isolates of bacterial wilt. HortScience 13:366.
Wakimoto, S., Utatsu, I., Masuo, N., and Hayashi, N. 1982. Multiplication of Pseudomonas
solanacearum in pure water. Annals of the Phytopathological Society of Japan 48:620-
627.
Walters, D. R., Fountaine, J. M. 2009. Practical application of induced resistance to plant
diseases: an appraisal of effectiveness under field conditions. Journal of Agricultural
Science 147:523–535.
Walters, D. R., Newton, A., Lyon, G. 2005. Induced resistance: Helping plants to help
themselves. Biologist 52:28-33.
Wang, J. F., Hanson, P., and Barnes, J. A. 1998. Worldwide evaluation of an international set of
resistance sources to bacterial wilt in tomato. Pages 269-275 in: Bacterial Wilt Disease:
Molecular and Ecological Aspects. P. Prior, C. Allen, and J. Elphinstone, eds. Springer
Verlag, Berlin, Germany.
Wenneker, M., Verdel, M. S. W., Groeneveld, R. M. W., Kempenaar, C., van Beuningen, A. R.,
and Janes, J. D. 1999. Ralstonia (Pseudomonas) solanacearum race 3 (biovar 2) in
surface water and natural weed hosts: First report on stinging nettle (Urtica dioica).
European Journal of Plant Pathology 105:307-315.
Wenneker, M., Verdel, M.S.W., Groeneveld, R.M.W., Kempenaar, C., van Beuningen, A.R.,
Xiao, L. Z., Zhu, Z. D., He, K. L., Zhou, M. N. Lin, G. F. 1983. Observations of the
infected portion of mulberry bacterial wilt by scanning electron microscopy. Science of
Sericulture (Canye Kexue). 9:58-59.
Winstead, N. N., and Kelman, A. 1952. Inoculation techniques for evaluation of resistance to
Pseudomonas solanacearum. Phytopathology 42:628-634.
Xu, J., Pan, Z. C., Prior, P., Xu, J. S., Zhang, Z., Zhang, H., Zhang, L. Q., He, L. Y., Feng, J.
2009: Genetic diversity of Ralstonia solanacearum strains from China. Eur. J. Plant
Pathol. 125:641–653.
Yabuuchi, E., Kosako, Y., Oyaizu, H., Yano, I., Hotta, H., Hashimoto. Y., Ezaki, T., and
Arakawa, M. 1992. Proposal of Burkholderia gen. nov. and transfer of seven species of
the genus Pseudomonas homology group II to the new genus, with the type species
Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiol. Immun.
36:251-1275.
105
BIOGRAPHICAL SKETCH
Sanju Kunwar graduated from high school in 2005 from Xavier Academy, Nepal. She
completed her undergraduate degree in Biotechnology from SANN International College of
Purbanchal University in Nepal. In June 2012, she joined the Plant Disease Diagnostic Clinic at
North Florida Research and Education Center, University of Florida as a research intern under
the supervision of Dr. Mathews Paret. In the clinic, she worked on the field management of
bacterial wilt disease of tomato (caused by Ralstonia solanacearum) and bacterial spot disease of
tomato (caused by Xanthomonas perforans). In January, 2013 she joined the Department of Plant
Pathology at University of Florida as a master student under the guidance of Dr. Mathews Paret
and Dr. Jeffery B. Jones. She conducted research on the integrated management of bacterial wilt
disease of tomato using a combination of grafting and application of Acibenzolar-S-Methyl, an
inducer of systemic acquired resistance in plants. During her master’s degree she was able to
publish a paper in Plant Disease entitled, “Grafting using rootstocks with resistance to Ralstonia
solanacearum against Meloidogyne incognita in tomato production” (in press) and co-authored
another paper in ACS Nano entitled “Nanotechnology in plant disease management: DNA-
directed silver nanoparticles on graphene oxide as an antibacterial against Xanthomonas
perforans” (in 2013).